Incidental Mutation 'R1450:Poteg'
ID162152
Institutional Source Beutler Lab
Gene Symbol Poteg
Ensembl Gene ENSMUSG00000063932
Gene NamePOTE ankyrin domain family, member G
Synonyms
MMRRC Submission 039505-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R1450 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location27447670-27495172 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27447843 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 5 (F5S)
Ref Sequence ENSEMBL: ENSMUSP00000147760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081321] [ENSMUST00000209669] [ENSMUST00000210427]
Predicted Effect probably benign
Transcript: ENSMUST00000081321
AA Change: F9S

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000080069
Gene: ENSMUSG00000063932
AA Change: F9S

DomainStartEndE-ValueType
ANK 80 109 1.46e-2 SMART
ANK 113 142 7.89e1 SMART
ANK 146 175 3.1e-6 SMART
ANK 179 208 2.81e-4 SMART
ANK 212 241 8.62e1 SMART
ANK 245 273 1.23e3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209669
Predicted Effect probably benign
Transcript: ENSMUST00000210427
AA Change: F5S

PolyPhen 2 Score 0.270 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211657
Meta Mutation Damage Score 0.21 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.0%
  • 20x: 84.8%
Validation Efficiency 96% (73/76)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013F07Rik T A 3: 108,542,483 probably null Het
Abca13 A T 11: 9,430,531 probably benign Het
Adh4 C T 3: 138,424,174 P254S probably damaging Het
Amfr T C 8: 93,987,747 T223A probably benign Het
Ank2 T C 3: 126,957,302 T412A possibly damaging Het
Bag6 T A 17: 35,141,958 D422E probably benign Het
Ccdc185 T G 1: 182,747,564 Q520P possibly damaging Het
Clock G A 5: 76,262,731 Q98* probably null Het
Cngb3 A T 4: 19,395,922 probably benign Het
Csmd1 T G 8: 15,945,180 probably null Het
Cubn A G 2: 13,360,319 L1636P probably damaging Het
Dennd4a A G 9: 64,911,665 I1701V probably benign Het
Dgcr2 T C 16: 17,856,814 H243R possibly damaging Het
Dimt1 A G 13: 106,947,643 N46S probably benign Het
Dnah9 T C 11: 65,927,786 Y58C probably damaging Het
Dsg1b T A 18: 20,409,184 V916E probably damaging Het
Dst T C 1: 34,188,395 S1690P probably damaging Het
Dst T A 1: 34,212,259 I2131K probably damaging Het
Epb41l1 T C 2: 156,511,825 probably benign Het
Fem1a T C 17: 56,257,579 V224A probably damaging Het
Got2 C T 8: 95,871,986 E203K probably benign Het
Hcar2 A T 5: 123,864,750 I230N probably damaging Het
Herc3 A T 6: 58,876,515 K554* probably null Het
Hfm1 A G 5: 106,918,458 F35L probably damaging Het
Hmcn1 A G 1: 150,652,506 probably benign Het
Hoxa13 C G 6: 52,260,647 probably benign Het
Hoxa13 G C 6: 52,260,648 probably benign Het
Hs2st1 C T 3: 144,434,718 probably benign Het
Igfbp5 T A 1: 72,873,889 D84V probably benign Het
Ints3 C A 3: 90,432,828 L41F probably damaging Het
Ipo5 T C 14: 120,944,393 V966A probably benign Het
Kif26a C T 12: 112,173,852 T505M probably damaging Het
Kpna2 A G 11: 106,997,309 S2P probably benign Het
Lct A G 1: 128,307,903 S456P probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrrc7 T G 3: 158,187,044 I323L possibly damaging Het
Ly6g A G 15: 75,158,633 K77R probably benign Het
Maea T C 5: 33,365,800 probably null Het
Marco A T 1: 120,476,745 probably benign Het
Mcmbp G T 7: 128,715,931 probably benign Het
Mtr T A 13: 12,193,733 R1017W probably damaging Het
Myo15 T A 11: 60,495,482 I1811N probably damaging Het
Nbeal2 G A 9: 110,633,672 probably benign Het
Nlrp10 A G 7: 108,925,388 V295A probably damaging Het
Olfr1328 T C 4: 118,934,510 T111A probably benign Het
Olfr513 A T 7: 108,755,512 I219F probably damaging Het
Olfr616 A G 7: 103,564,451 V276A probably benign Het
Pde4b A T 4: 102,601,635 Q496L probably damaging Het
Peg12 C A 7: 62,463,576 G258* probably null Het
Pigc A G 1: 161,971,253 Y268C probably benign Het
Pnisr G T 4: 21,874,912 probably null Het
Prss40 T A 1: 34,556,097 I101F probably benign Het
Ptges3l T A 11: 101,421,905 D113V possibly damaging Het
Raver2 T C 4: 101,136,152 S510P possibly damaging Het
Rgr A T 14: 37,044,684 C94* probably null Het
Rp1l1 T A 14: 64,028,150 I395N probably benign Het
Sesn3 T A 9: 14,316,224 H168Q possibly damaging Het
Soga3 A T 10: 29,147,740 N361I probably damaging Het
Sox30 C A 11: 46,017,271 P755Q probably damaging Het
Stac3 T C 10: 127,504,885 F173S probably damaging Het
Synj2 C A 17: 6,027,324 probably benign Het
Tarsl2 A T 7: 65,647,496 I120L probably benign Het
Tas2r124 A G 6: 132,755,056 I109M probably damaging Het
Tm4sf19 A T 16: 32,407,963 H190L probably damaging Het
Tmem143 T G 7: 45,907,108 V179G probably damaging Het
Ubr4 T C 4: 139,468,028 F1187S probably damaging Het
Ubtfl1 A G 9: 18,409,913 R246G possibly damaging Het
Zdhhc5 A G 2: 84,702,389 F57S probably damaging Het
Zfp40 A T 17: 23,175,258 M717K probably benign Het
Other mutations in Poteg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Poteg APN 8 27473620 splice site probably benign
IGL01964:Poteg APN 8 27448008 missense probably damaging 0.99
IGL03017:Poteg APN 8 27462041 missense probably benign 0.01
R0034:Poteg UTSW 8 27462077 splice site probably benign
R0069:Poteg UTSW 8 27447821 missense probably benign 0.33
R0069:Poteg UTSW 8 27447821 missense probably benign 0.33
R0522:Poteg UTSW 8 27449958 missense possibly damaging 0.95
R0634:Poteg UTSW 8 27473587 missense probably benign 0.20
R0971:Poteg UTSW 8 27447939 missense probably damaging 1.00
R1019:Poteg UTSW 8 27447824 missense possibly damaging 0.46
R1603:Poteg UTSW 8 27448005 start codon destroyed probably null 0.56
R1650:Poteg UTSW 8 27463785 missense probably benign 0.04
R1656:Poteg UTSW 8 27495032 intron probably benign
R1818:Poteg UTSW 8 27450167 nonsense probably null
R2048:Poteg UTSW 8 27456746 missense probably benign 0.39
R2847:Poteg UTSW 8 27481676 missense probably benign 0.10
R2848:Poteg UTSW 8 27481676 missense probably benign 0.10
R2849:Poteg UTSW 8 27481676 missense probably benign 0.10
R4493:Poteg UTSW 8 27480097 missense possibly damaging 0.68
R4967:Poteg UTSW 8 27494981 intron probably benign
R5051:Poteg UTSW 8 27453329 missense possibly damaging 0.78
R5149:Poteg UTSW 8 27481643 missense possibly damaging 0.93
R5579:Poteg UTSW 8 27448037 missense probably damaging 1.00
R5594:Poteg UTSW 8 27447968 missense probably benign 0.28
R5723:Poteg UTSW 8 27449992 critical splice donor site probably null
R5804:Poteg UTSW 8 27456798 missense probably damaging 1.00
R6685:Poteg UTSW 8 27447905 missense possibly damaging 0.91
R6911:Poteg UTSW 8 27450298 missense probably damaging 0.97
R7044:Poteg UTSW 8 27449895 missense probably damaging 1.00
R7096:Poteg UTSW 8 27473567 missense not run
X0063:Poteg UTSW 8 27450154 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCAACTGTGCCTCTACCAAC -3'
(R):5'- AGAAGACAGGAAGACAGCCCTTCTC -3'

Sequencing Primer
(F):5'- GTGCCTCTACCAACTGTATAAGG -3'
(R):5'- GTACACGTTGCATTGTCCAAG -3'
Posted On2014-03-14