Incidental Mutation 'R1450:Stac3'
ID162160
Institutional Source Beutler Lab
Gene Symbol Stac3
Ensembl Gene ENSMUSG00000040287
Gene NameSH3 and cysteine rich domain 3
Synonyms
MMRRC Submission 039505-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1450 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location127501686-127508823 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127504885 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 173 (F173S)
Ref Sequence ENSEMBL: ENSMUSP00000125124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035839] [ENSMUST00000160019] [ENSMUST00000160610]
Predicted Effect probably damaging
Transcript: ENSMUST00000035839
AA Change: F173S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048148
Gene: ENSMUSG00000040287
AA Change: F173S

DomainStartEndE-ValueType
low complexity region 35 46 N/A INTRINSIC
low complexity region 65 81 N/A INTRINSIC
C1 89 139 2.19e-7 SMART
low complexity region 199 213 N/A INTRINSIC
low complexity region 220 238 N/A INTRINSIC
SH3 246 301 1.41e-16 SMART
SH3 305 360 8.45e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160019
AA Change: F173S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125124
Gene: ENSMUSG00000040287
AA Change: F173S

DomainStartEndE-ValueType
low complexity region 35 46 N/A INTRINSIC
low complexity region 65 81 N/A INTRINSIC
C1 89 139 2.19e-7 SMART
low complexity region 199 213 N/A INTRINSIC
low complexity region 220 238 N/A INTRINSIC
SH3 246 301 1.41e-16 SMART
SH3 305 360 8.45e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160760
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162302
Meta Mutation Damage Score 0.166 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.0%
  • 20x: 84.8%
Validation Efficiency 96% (73/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the excitation-contraction coupling machinery of muscles. This protein is a member of the Stac gene family and contains an N-terminal cysteine-rich domain and two SH3 domains. Mutations in this gene are a cause of Native American myopathy. [provided by RefSeq, Nov 2013]
PHENOTYPE: Homozygous inactivation of this gene leads to neonatal lethality, abnormal posture, thin diaphragm muscle, abnormal skeletal muscle morphology characterized by centralized nuclei and disorganized myofibrils, and impaired skeletal muscle contractility due to defective excitation-contraction coupling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013F07Rik T A 3: 108,542,483 probably null Het
Abca13 A T 11: 9,430,531 probably benign Het
Adh4 C T 3: 138,424,174 P254S probably damaging Het
Amfr T C 8: 93,987,747 T223A probably benign Het
Ank2 T C 3: 126,957,302 T412A possibly damaging Het
Bag6 T A 17: 35,141,958 D422E probably benign Het
Ccdc185 T G 1: 182,747,564 Q520P possibly damaging Het
Clock G A 5: 76,262,731 Q98* probably null Het
Cngb3 A T 4: 19,395,922 probably benign Het
Csmd1 T G 8: 15,945,180 probably null Het
Cubn A G 2: 13,360,319 L1636P probably damaging Het
Dennd4a A G 9: 64,911,665 I1701V probably benign Het
Dgcr2 T C 16: 17,856,814 H243R possibly damaging Het
Dimt1 A G 13: 106,947,643 N46S probably benign Het
Dnah9 T C 11: 65,927,786 Y58C probably damaging Het
Dsg1b T A 18: 20,409,184 V916E probably damaging Het
Dst T C 1: 34,188,395 S1690P probably damaging Het
Dst T A 1: 34,212,259 I2131K probably damaging Het
Epb41l1 T C 2: 156,511,825 probably benign Het
Fem1a T C 17: 56,257,579 V224A probably damaging Het
Got2 C T 8: 95,871,986 E203K probably benign Het
Hcar2 A T 5: 123,864,750 I230N probably damaging Het
Herc3 A T 6: 58,876,515 K554* probably null Het
Hfm1 A G 5: 106,918,458 F35L probably damaging Het
Hmcn1 A G 1: 150,652,506 probably benign Het
Hoxa13 C G 6: 52,260,647 probably benign Het
Hoxa13 G C 6: 52,260,648 probably benign Het
Hs2st1 C T 3: 144,434,718 probably benign Het
Igfbp5 T A 1: 72,873,889 D84V probably benign Het
Ints3 C A 3: 90,432,828 L41F probably damaging Het
Ipo5 T C 14: 120,944,393 V966A probably benign Het
Kif26a C T 12: 112,173,852 T505M probably damaging Het
Kpna2 A G 11: 106,997,309 S2P probably benign Het
Lct A G 1: 128,307,903 S456P probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrrc7 T G 3: 158,187,044 I323L possibly damaging Het
Ly6g A G 15: 75,158,633 K77R probably benign Het
Maea T C 5: 33,365,800 probably null Het
Marco A T 1: 120,476,745 probably benign Het
Mcmbp G T 7: 128,715,931 probably benign Het
Mtr T A 13: 12,193,733 R1017W probably damaging Het
Myo15 T A 11: 60,495,482 I1811N probably damaging Het
Nbeal2 G A 9: 110,633,672 probably benign Het
Nlrp10 A G 7: 108,925,388 V295A probably damaging Het
Olfr1328 T C 4: 118,934,510 T111A probably benign Het
Olfr513 A T 7: 108,755,512 I219F probably damaging Het
Olfr616 A G 7: 103,564,451 V276A probably benign Het
Pde4b A T 4: 102,601,635 Q496L probably damaging Het
Peg12 C A 7: 62,463,576 G258* probably null Het
Pigc A G 1: 161,971,253 Y268C probably benign Het
Pnisr G T 4: 21,874,912 probably null Het
Poteg T C 8: 27,447,843 F5S probably benign Het
Prss40 T A 1: 34,556,097 I101F probably benign Het
Ptges3l T A 11: 101,421,905 D113V possibly damaging Het
Raver2 T C 4: 101,136,152 S510P possibly damaging Het
Rgr A T 14: 37,044,684 C94* probably null Het
Rp1l1 T A 14: 64,028,150 I395N probably benign Het
Sesn3 T A 9: 14,316,224 H168Q possibly damaging Het
Soga3 A T 10: 29,147,740 N361I probably damaging Het
Sox30 C A 11: 46,017,271 P755Q probably damaging Het
Synj2 C A 17: 6,027,324 probably benign Het
Tarsl2 A T 7: 65,647,496 I120L probably benign Het
Tas2r124 A G 6: 132,755,056 I109M probably damaging Het
Tm4sf19 A T 16: 32,407,963 H190L probably damaging Het
Tmem143 T G 7: 45,907,108 V179G probably damaging Het
Ubr4 T C 4: 139,468,028 F1187S probably damaging Het
Ubtfl1 A G 9: 18,409,913 R246G possibly damaging Het
Zdhhc5 A G 2: 84,702,389 F57S probably damaging Het
Zfp40 A T 17: 23,175,258 M717K probably benign Het
Other mutations in Stac3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Stac3 APN 10 127503664 missense probably damaging 1.00
IGL02271:Stac3 APN 10 127503899 missense probably benign 0.00
R0051:Stac3 UTSW 10 127508148 missense probably damaging 0.98
R0090:Stac3 UTSW 10 127503930 unclassified probably benign
R0131:Stac3 UTSW 10 127503650 missense probably damaging 0.97
R0131:Stac3 UTSW 10 127503650 missense probably damaging 0.97
R0132:Stac3 UTSW 10 127503650 missense probably damaging 0.97
R0330:Stac3 UTSW 10 127507747 synonymous probably null
R0630:Stac3 UTSW 10 127507763 missense probably damaging 1.00
R1132:Stac3 UTSW 10 127507259 missense probably benign
R1739:Stac3 UTSW 10 127507766 missense probably benign 0.40
R2316:Stac3 UTSW 10 127503360 splice site probably null
R2511:Stac3 UTSW 10 127503918 critical splice donor site probably null
R3000:Stac3 UTSW 10 127508147 missense probably benign 0.01
R4324:Stac3 UTSW 10 127503249 missense probably damaging 0.99
R4758:Stac3 UTSW 10 127503345 missense possibly damaging 0.95
R5040:Stac3 UTSW 10 127508124 missense probably damaging 0.98
R6244:Stac3 UTSW 10 127508175 missense probably damaging 1.00
R6275:Stac3 UTSW 10 127507746 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATTCCCAGTGGTGGTTTAGAGCCC -3'
(R):5'- GCCCACAGTGAGATGAATAAGCGTG -3'

Sequencing Primer
(F):5'- AGAGCCCTTAACCTCTAGGTG -3'
(R):5'- cacacacacacacacacac -3'
Posted On2014-03-14