Incidental Mutation 'R1450:Sox30'
ID162162
Institutional Source Beutler Lab
Gene Symbol Sox30
Ensembl Gene ENSMUSG00000040489
Gene NameSRY (sex determining region Y)-box 30
Synonyms
MMRRC Submission 039505-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R1450 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location45980310-46017994 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 46017271 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 755 (P755Q)
Ref Sequence ENSEMBL: ENSMUSP00000037519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049038]
Predicted Effect probably damaging
Transcript: ENSMUST00000049038
AA Change: P755Q

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000037519
Gene: ENSMUSG00000040489
AA Change: P755Q

DomainStartEndE-ValueType
low complexity region 3 36 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
low complexity region 50 80 N/A INTRINSIC
low complexity region 92 104 N/A INTRINSIC
low complexity region 110 141 N/A INTRINSIC
low complexity region 210 220 N/A INTRINSIC
HMG 365 435 8.35e-24 SMART
low complexity region 523 539 N/A INTRINSIC
Blast:Pept_C1 572 734 1e-92 BLAST
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.0%
  • 20x: 84.8%
Validation Efficiency 96% (73/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein acts as a transcriptional regulator when present in a complex with other proteins. It can activate p53 transcription to promote tumor cell apoptosis in lung cancer. The protein may be involved in the differentiation of developing male germ cells. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 5. [provided by RefSeq, Apr 2015]
PHENOTYPE: Male mice homozygous for a null allele are infertile with arrest of spermiogenesis and azoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013F07Rik T A 3: 108,542,483 probably null Het
Abca13 A T 11: 9,430,531 probably benign Het
Adh4 C T 3: 138,424,174 P254S probably damaging Het
Amfr T C 8: 93,987,747 T223A probably benign Het
Ank2 T C 3: 126,957,302 T412A possibly damaging Het
Bag6 T A 17: 35,141,958 D422E probably benign Het
Ccdc185 T G 1: 182,747,564 Q520P possibly damaging Het
Clock G A 5: 76,262,731 Q98* probably null Het
Cngb3 A T 4: 19,395,922 probably benign Het
Csmd1 T G 8: 15,945,180 probably null Het
Cubn A G 2: 13,360,319 L1636P probably damaging Het
Dennd4a A G 9: 64,911,665 I1701V probably benign Het
Dgcr2 T C 16: 17,856,814 H243R possibly damaging Het
Dimt1 A G 13: 106,947,643 N46S probably benign Het
Dnah9 T C 11: 65,927,786 Y58C probably damaging Het
Dsg1b T A 18: 20,409,184 V916E probably damaging Het
Dst T C 1: 34,188,395 S1690P probably damaging Het
Dst T A 1: 34,212,259 I2131K probably damaging Het
Epb41l1 T C 2: 156,511,825 probably benign Het
Fem1a T C 17: 56,257,579 V224A probably damaging Het
Got2 C T 8: 95,871,986 E203K probably benign Het
Hcar2 A T 5: 123,864,750 I230N probably damaging Het
Herc3 A T 6: 58,876,515 K554* probably null Het
Hfm1 A G 5: 106,918,458 F35L probably damaging Het
Hmcn1 A G 1: 150,652,506 probably benign Het
Hoxa13 C G 6: 52,260,647 probably benign Het
Hoxa13 G C 6: 52,260,648 probably benign Het
Hs2st1 C T 3: 144,434,718 probably benign Het
Igfbp5 T A 1: 72,873,889 D84V probably benign Het
Ints3 C A 3: 90,432,828 L41F probably damaging Het
Ipo5 T C 14: 120,944,393 V966A probably benign Het
Kif26a C T 12: 112,173,852 T505M probably damaging Het
Kpna2 A G 11: 106,997,309 S2P probably benign Het
Lct A G 1: 128,307,903 S456P probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrrc7 T G 3: 158,187,044 I323L possibly damaging Het
Ly6g A G 15: 75,158,633 K77R probably benign Het
Maea T C 5: 33,365,800 probably null Het
Marco A T 1: 120,476,745 probably benign Het
Mcmbp G T 7: 128,715,931 probably benign Het
Mtr T A 13: 12,193,733 R1017W probably damaging Het
Myo15 T A 11: 60,495,482 I1811N probably damaging Het
Nbeal2 G A 9: 110,633,672 probably benign Het
Nlrp10 A G 7: 108,925,388 V295A probably damaging Het
Olfr1328 T C 4: 118,934,510 T111A probably benign Het
Olfr513 A T 7: 108,755,512 I219F probably damaging Het
Olfr616 A G 7: 103,564,451 V276A probably benign Het
Pde4b A T 4: 102,601,635 Q496L probably damaging Het
Peg12 C A 7: 62,463,576 G258* probably null Het
Pigc A G 1: 161,971,253 Y268C probably benign Het
Pnisr G T 4: 21,874,912 probably null Het
Poteg T C 8: 27,447,843 F5S probably benign Het
Prss40 T A 1: 34,556,097 I101F probably benign Het
Ptges3l T A 11: 101,421,905 D113V possibly damaging Het
Raver2 T C 4: 101,136,152 S510P possibly damaging Het
Rgr A T 14: 37,044,684 C94* probably null Het
Rp1l1 T A 14: 64,028,150 I395N probably benign Het
Sesn3 T A 9: 14,316,224 H168Q possibly damaging Het
Soga3 A T 10: 29,147,740 N361I probably damaging Het
Stac3 T C 10: 127,504,885 F173S probably damaging Het
Synj2 C A 17: 6,027,324 probably benign Het
Tarsl2 A T 7: 65,647,496 I120L probably benign Het
Tas2r124 A G 6: 132,755,056 I109M probably damaging Het
Tm4sf19 A T 16: 32,407,963 H190L probably damaging Het
Tmem143 T G 7: 45,907,108 V179G probably damaging Het
Ubr4 T C 4: 139,468,028 F1187S probably damaging Het
Ubtfl1 A G 9: 18,409,913 R246G possibly damaging Het
Zdhhc5 A G 2: 84,702,389 F57S probably damaging Het
Zfp40 A T 17: 23,175,258 M717K probably benign Het
Other mutations in Sox30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Sox30 APN 11 45991900 missense possibly damaging 0.95
IGL01449:Sox30 APN 11 45981342 missense probably damaging 1.00
IGL02411:Sox30 APN 11 45981124 nonsense probably null
IGL02601:Sox30 APN 11 45984762 missense possibly damaging 0.81
IGL02747:Sox30 APN 11 45980945 missense probably benign 0.00
IGL03403:Sox30 APN 11 46017208 missense probably damaging 1.00
R0104:Sox30 UTSW 11 45981314 missense possibly damaging 0.93
R2109:Sox30 UTSW 11 45991768 missense probably damaging 0.99
R2213:Sox30 UTSW 11 45984852 missense probably damaging 1.00
R3715:Sox30 UTSW 11 45984792 missense probably damaging 0.99
R4111:Sox30 UTSW 11 46017214 missense probably benign 0.09
R4723:Sox30 UTSW 11 45984765 missense probably benign 0.03
R5014:Sox30 UTSW 11 45991909 missense probably benign 0.01
R5408:Sox30 UTSW 11 45991867 missense possibly damaging 0.54
R5974:Sox30 UTSW 11 45981073 missense probably damaging 0.99
R6063:Sox30 UTSW 11 45991942 missense probably benign 0.04
R6948:Sox30 UTSW 11 46017339 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACTTAACTCATAGTCTGTGGCCC -3'
(R):5'- ATGAACGGCACTTGGTCCTGACTC -3'

Sequencing Primer
(F):5'- TCCAAGTTCAATGCCAGAATGTC -3'
(R):5'- TCCTCAGATCATGGCTGAAAAC -3'
Posted On2014-03-14