Incidental Mutation 'R1450:Ptges3l'
ID162165
Institutional Source Beutler Lab
Gene Symbol Ptges3l
Ensembl Gene ENSMUSG00000097487
Gene Nameprostaglandin E synthase 3 like
Synonyms1110069E20Rik, 1700113I22Rik
MMRRC Submission 039505-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock #R1450 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location101418812-101425333 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101421905 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 113 (D113V)
Ref Sequence ENSEMBL: ENSMUSP00000102880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040561] [ENSMUST00000070395] [ENSMUST00000093933] [ENSMUST00000103102] [ENSMUST00000107252] [ENSMUST00000107257] [ENSMUST00000107259]
Predicted Effect probably benign
Transcript: ENSMUST00000040561
SMART Domains Protein: ENSMUSP00000042151
Gene: ENSMUSG00000035007

DomainStartEndE-ValueType
low complexity region 43 75 N/A INTRINSIC
coiled coil region 80 102 N/A INTRINSIC
coiled coil region 165 201 N/A INTRINSIC
low complexity region 327 338 N/A INTRINSIC
RUN 540 602 2.77e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000070395
SMART Domains Protein: ENSMUSP00000067912
Gene: ENSMUSG00000075528

DomainStartEndE-ValueType
Pfam:tRNA-synt_2c 8 101 1.5e-8 PFAM
tRNA_SAD 196 239 1.43e-6 SMART
low complexity region 276 293 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000093933
AA Change: D113V

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000091465
Gene: ENSMUSG00000097487
AA Change: D113V

DomainStartEndE-ValueType
Pfam:CS 6 80 8.7e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000103102
AA Change: D113V

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099391
Gene: ENSMUSG00000097487
AA Change: D113V

DomainStartEndE-ValueType
Pfam:CS 6 80 7.3e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107252
AA Change: D113V

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102873
Gene: ENSMUSG00000097487
AA Change: D113V

DomainStartEndE-ValueType
Pfam:CS 6 80 9.6e-9 PFAM
low complexity region 141 149 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107257
AA Change: D95V

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102878
Gene: ENSMUSG00000097239
AA Change: D95V

DomainStartEndE-ValueType
Pfam:tRNA-synt_2c 91 214 1.4e-8 PFAM
tRNA_SAD 309 352 1.43e-6 SMART
low complexity region 389 406 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107259
AA Change: D113V

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102880
Gene: ENSMUSG00000097239
AA Change: D113V

DomainStartEndE-ValueType
Pfam:tRNA-synt_2c 109 232 3.4e-9 PFAM
tRNA_SAD 327 370 1.43e-6 SMART
low complexity region 407 424 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133240
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140123
Predicted Effect unknown
Transcript: ENSMUST00000149706
AA Change: D42V
SMART Domains Protein: ENSMUSP00000116399
Gene: ENSMUSG00000097487
AA Change: D42V

DomainStartEndE-ValueType
SCOP:d1ejfa_ 2 41 6e-11 SMART
PDB:1EJF|B 2 56 2e-13 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150957
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185077
Meta Mutation Damage Score 0.334 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.0%
  • 20x: 84.8%
Validation Efficiency 96% (73/76)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013F07Rik T A 3: 108,542,483 probably null Het
Abca13 A T 11: 9,430,531 probably benign Het
Adh4 C T 3: 138,424,174 P254S probably damaging Het
Amfr T C 8: 93,987,747 T223A probably benign Het
Ank2 T C 3: 126,957,302 T412A possibly damaging Het
Bag6 T A 17: 35,141,958 D422E probably benign Het
Ccdc185 T G 1: 182,747,564 Q520P possibly damaging Het
Clock G A 5: 76,262,731 Q98* probably null Het
Cngb3 A T 4: 19,395,922 probably benign Het
Csmd1 T G 8: 15,945,180 probably null Het
Cubn A G 2: 13,360,319 L1636P probably damaging Het
Dennd4a A G 9: 64,911,665 I1701V probably benign Het
Dgcr2 T C 16: 17,856,814 H243R possibly damaging Het
Dimt1 A G 13: 106,947,643 N46S probably benign Het
Dnah9 T C 11: 65,927,786 Y58C probably damaging Het
Dsg1b T A 18: 20,409,184 V916E probably damaging Het
Dst T C 1: 34,188,395 S1690P probably damaging Het
Dst T A 1: 34,212,259 I2131K probably damaging Het
Epb41l1 T C 2: 156,511,825 probably benign Het
Fem1a T C 17: 56,257,579 V224A probably damaging Het
Got2 C T 8: 95,871,986 E203K probably benign Het
Hcar2 A T 5: 123,864,750 I230N probably damaging Het
Herc3 A T 6: 58,876,515 K554* probably null Het
Hfm1 A G 5: 106,918,458 F35L probably damaging Het
Hmcn1 A G 1: 150,652,506 probably benign Het
Hoxa13 C G 6: 52,260,647 probably benign Het
Hoxa13 G C 6: 52,260,648 probably benign Het
Hs2st1 C T 3: 144,434,718 probably benign Het
Igfbp5 T A 1: 72,873,889 D84V probably benign Het
Ints3 C A 3: 90,432,828 L41F probably damaging Het
Ipo5 T C 14: 120,944,393 V966A probably benign Het
Kif26a C T 12: 112,173,852 T505M probably damaging Het
Kpna2 A G 11: 106,997,309 S2P probably benign Het
Lct A G 1: 128,307,903 S456P probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrrc7 T G 3: 158,187,044 I323L possibly damaging Het
Ly6g A G 15: 75,158,633 K77R probably benign Het
Maea T C 5: 33,365,800 probably null Het
Marco A T 1: 120,476,745 probably benign Het
Mcmbp G T 7: 128,715,931 probably benign Het
Mtr T A 13: 12,193,733 R1017W probably damaging Het
Myo15 T A 11: 60,495,482 I1811N probably damaging Het
Nbeal2 G A 9: 110,633,672 probably benign Het
Nlrp10 A G 7: 108,925,388 V295A probably damaging Het
Olfr1328 T C 4: 118,934,510 T111A probably benign Het
Olfr513 A T 7: 108,755,512 I219F probably damaging Het
Olfr616 A G 7: 103,564,451 V276A probably benign Het
Pde4b A T 4: 102,601,635 Q496L probably damaging Het
Peg12 C A 7: 62,463,576 G258* probably null Het
Pigc A G 1: 161,971,253 Y268C probably benign Het
Pnisr G T 4: 21,874,912 probably null Het
Poteg T C 8: 27,447,843 F5S probably benign Het
Prss40 T A 1: 34,556,097 I101F probably benign Het
Raver2 T C 4: 101,136,152 S510P possibly damaging Het
Rgr A T 14: 37,044,684 C94* probably null Het
Rp1l1 T A 14: 64,028,150 I395N probably benign Het
Sesn3 T A 9: 14,316,224 H168Q possibly damaging Het
Soga3 A T 10: 29,147,740 N361I probably damaging Het
Sox30 C A 11: 46,017,271 P755Q probably damaging Het
Stac3 T C 10: 127,504,885 F173S probably damaging Het
Synj2 C A 17: 6,027,324 probably benign Het
Tarsl2 A T 7: 65,647,496 I120L probably benign Het
Tas2r124 A G 6: 132,755,056 I109M probably damaging Het
Tm4sf19 A T 16: 32,407,963 H190L probably damaging Het
Tmem143 T G 7: 45,907,108 V179G probably damaging Het
Ubr4 T C 4: 139,468,028 F1187S probably damaging Het
Ubtfl1 A G 9: 18,409,913 R246G possibly damaging Het
Zdhhc5 A G 2: 84,702,389 F57S probably damaging Het
Zfp40 A T 17: 23,175,258 M717K probably benign Het
Other mutations in Ptges3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00851:Ptges3l APN 11 101423790 missense possibly damaging 0.62
IGL01955:Ptges3l APN 11 101423818 missense possibly damaging 0.94
R1183:Ptges3l UTSW 11 101421905 missense possibly damaging 0.79
R2513:Ptges3l UTSW 11 101424042 missense possibly damaging 0.81
R3830:Ptges3l UTSW 11 101421617 makesense probably null
R4846:Ptges3l UTSW 11 101419184 unclassified probably benign
R4965:Ptges3l UTSW 11 101424622 start codon destroyed probably null 0.32
Predicted Primers PCR Primer
(F):5'- GGCCCACTGAGGAAGTTCCAATATC -3'
(R):5'- AGGATGCTTTGTGTTGACCACCC -3'

Sequencing Primer
(F):5'- GGAAGTTCCAATATCCCGGTCTG -3'
(R):5'- GGTAGAACTCTGCTTTTTCAGAC -3'
Posted On2014-03-14