Incidental Mutation 'R1454:Olfr156'
ID162192
Institutional Source Beutler Lab
Gene Symbol Olfr156
Ensembl Gene ENSMUSG00000110970
Gene Nameolfactory receptor 156
SynonymsGA_x6K02T2N78B-16125144-16126100, OR37B, Olfr37b, mOR37b, MOR262-6
MMRRC Submission 039509-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R1454 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location43820132-43823895 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43820639 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 241 (C241S)
Ref Sequence ENSEMBL: ENSMUSP00000148995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079234] [ENSMUST00000079465] [ENSMUST00000214843] [ENSMUST00000215406]
Predicted Effect probably damaging
Transcript: ENSMUST00000079234
AA Change: C241S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078226
Gene: ENSMUSG00000110970
AA Change: C241S

DomainStartEndE-ValueType
Pfam:7tm_4 31 314 4.8e-58 PFAM
Pfam:7tm_1 41 296 2.9e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000079465
AA Change: C241S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078431
Gene: ENSMUSG00000110970
AA Change: C241S

DomainStartEndE-ValueType
Pfam:7tm_4 31 314 1.2e-58 PFAM
Pfam:7tm_1 41 296 6.5e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214843
AA Change: C241S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215406
AA Change: C241S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.0296 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts5 A G 16: 85,869,993 V537A possibly damaging Het
Adcy10 A T 1: 165,515,380 I272F possibly damaging Het
Adcy6 A G 15: 98,604,728 S2P probably damaging Het
Agap1 A G 1: 89,837,806 probably null Het
Aldh3a2 A G 11: 61,265,102 V116A probably benign Het
Ankdd1b A T 13: 96,433,405 probably null Het
Antxrl G A 14: 34,060,949 V233I probably damaging Het
Atp8b5 A G 4: 43,302,590 I38V probably benign Het
Atxn7l2 A G 3: 108,208,432 probably benign Het
Bfsp2 A T 9: 103,480,225 M1K probably null Het
Camsap3 T A 8: 3,603,968 I520N possibly damaging Het
Cenpc1 C T 5: 86,013,510 V854I possibly damaging Het
Csnk2a1 T C 2: 152,257,427 L88S probably damaging Het
Dcaf17 A G 2: 71,073,173 N171D probably damaging Het
Dctn1 G C 6: 83,197,508 A1077P possibly damaging Het
Dock1 T C 7: 134,851,609 probably benign Het
Egfr A T 11: 16,889,920 I645L probably benign Het
Gdpd1 T G 11: 87,059,509 K79N possibly damaging Het
Ggt5 A T 10: 75,609,908 L432F probably benign Het
Gm11060 A G 2: 105,093,752 T22A unknown Het
Gpr132 G A 12: 112,852,240 T322I possibly damaging Het
Grin1 G A 2: 25,292,430 R940* probably null Het
Hip1 T C 5: 135,438,632 T316A probably benign Het
Hnrnpm A G 17: 33,666,488 probably benign Het
Hsd3b5 G A 3: 98,619,530 T200I probably benign Het
Hspa9 A T 18: 34,938,606 L647H probably damaging Het
Itgad T C 7: 128,192,137 I727T probably benign Het
Kcnma1 T C 14: 23,463,200 D522G probably damaging Het
Lipf C T 19: 33,970,732 probably benign Het
Ly6i T C 15: 74,983,055 D2G possibly damaging Het
Mast1 G A 8: 84,920,635 P631L probably damaging Het
Mmp1b G C 9: 7,386,693 L144V probably damaging Het
Msh6 A G 17: 87,984,758 S314G probably benign Het
Myo5c G A 9: 75,263,066 V493I possibly damaging Het
Nefm A G 14: 68,121,379 L402P probably damaging Het
Nrxn2 T C 19: 6,481,446 F697S probably damaging Het
Pex13 A G 11: 23,649,422 I363T probably benign Het
Plcb3 T C 19: 6,955,046 R1082G possibly damaging Het
Psg28 A T 7: 18,427,964 S205T possibly damaging Het
Pxt1 C A 17: 28,934,782 V26L possibly damaging Het
Ripk2 G A 4: 16,163,239 T53M probably damaging Het
Slc5a9 A G 4: 111,883,964 V495A probably benign Het
Snrpa T C 7: 27,192,937 K66R probably benign Het
Srgap1 T A 10: 121,896,738 E145V probably damaging Het
Suz12 A G 11: 80,032,113 T694A probably benign Het
Tatdn2 T A 6: 113,704,327 D440E probably benign Het
Tbc1d21 A G 9: 58,362,813 probably null Het
Tbc1d31 T A 15: 57,951,638 Y570* probably null Het
Tbc1d32 A T 10: 56,177,479 probably benign Het
Tdrd5 G C 1: 156,259,836 Q839E probably benign Het
Tecpr2 A G 12: 110,968,953 N1402S probably benign Het
Thbs1 A G 2: 118,122,672 D921G probably damaging Het
Tll1 A G 8: 64,038,490 V803A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trpm4 T C 7: 45,317,056 E461G probably damaging Het
Zp3 T A 5: 135,984,188 I152N probably damaging Het
Other mutations in Olfr156
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02508:Olfr156 APN 4 43821289 missense possibly damaging 0.83
IGL02690:Olfr156 APN 4 43821190 missense possibly damaging 0.50
R1465:Olfr156 UTSW 4 43820723 missense probably benign 0.00
R1465:Olfr156 UTSW 4 43820723 missense probably benign 0.00
R1859:Olfr156 UTSW 4 43820779 missense possibly damaging 0.91
R2146:Olfr156 UTSW 4 43821178 missense probably damaging 1.00
R3160:Olfr156 UTSW 4 43820544 missense probably benign 0.04
R3162:Olfr156 UTSW 4 43820544 missense probably benign 0.04
R3162:Olfr156 UTSW 4 43820544 missense probably benign 0.04
R3414:Olfr156 UTSW 4 43821258 missense probably benign 0.00
R3936:Olfr156 UTSW 4 43821359 start codon destroyed probably benign 0.01
R4497:Olfr156 UTSW 4 43821175 missense probably damaging 1.00
R4631:Olfr156 UTSW 4 43820563 missense probably benign 0.08
R5125:Olfr156 UTSW 4 43820480 missense probably benign 0.15
R5371:Olfr156 UTSW 4 43821058 missense probably damaging 1.00
R5698:Olfr156 UTSW 4 43821183 missense probably damaging 1.00
R5807:Olfr156 UTSW 4 43820912 missense probably benign 0.00
R5889:Olfr156 UTSW 4 43820492 missense possibly damaging 0.89
R6461:Olfr156 UTSW 4 43821355 missense probably benign
R6865:Olfr156 UTSW 4 43821346 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCATTTCTGACCTACCAGGTTCC -3'
(R):5'- TGAACAAGTCTGCCTATGTGCCC -3'

Sequencing Primer
(F):5'- TACCAGGTTCCTCACAGCG -3'
(R):5'- CTGTGGGGACAATGTCATCAATC -3'
Posted On2014-03-14