Incidental Mutation 'R1454:Zp3'
ID162196
Institutional Source Beutler Lab
Gene Symbol Zp3
Ensembl Gene ENSMUSG00000004948
Gene Namezona pellucida glycoprotein 3
SynonymsZp-3
MMRRC Submission 039509-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R1454 (G1)
Quality Score214
Status Validated
Chromosome5
Chromosomal Location135980099-135988624 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 135984188 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 152 (I152N)
Ref Sequence ENSEMBL: ENSMUSP00000005073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005073]
PDB Structure
ZP-N domain of mammalian sperm receptor ZP3 (crystal form I) [X-RAY DIFFRACTION]
ZP-N domain of mammalian sperm receptor ZP3 (crystal form II) [X-RAY DIFFRACTION]
ZP-N domain of mammalian sperm receptor ZP3 (crystal form III) [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000005073
AA Change: I152N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000005073
Gene: ENSMUSG00000004948
AA Change: I152N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
ZP 45 304 1.22e-68 SMART
low complexity region 320 334 N/A INTRINSIC
transmembrane domain 387 409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131563
SMART Domains Protein: ENSMUSP00000120447
Gene: ENSMUSG00000004948

DomainStartEndE-ValueType
Pfam:Zona_pellucida 35 136 6.4e-16 PFAM
Meta Mutation Damage Score 0.324 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The zona pellucida is an extracellular matrix that surrounds the oocyte and early embryo. It is composed primarily of three or four glycoproteins with various functions during fertilization and preimplantation development. The protein encoded by this gene is a structural component of the zona pellucida and functions in primary binding and induction of the sperm acrosome reaction. The nascent protein contains a N-terminal signal peptide sequence, a conserved ZP domain, a C-terminal consensus furin cleavage site, and a transmembrane domain. It is hypothesized that furin cleavage results in release of the mature protein from the plasma membrane for subsequent incorporation into the zona pellucida matrix. However, the requirement for furin cleavage in this process remains controversial based on mouse studies. A variation in the last exon of this gene has previously served as the basis for an additional ZP3 locus; however, sequence and literature review reveals that there is only one full-length ZP3 locus in the human genome. Another locus encoding a bipartite transcript designated POMZP3 contains a duplication of the last four exons of ZP3, including the above described variation, and maps closely to this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous female mutants are infertile. In these females oocytes lack a zona pellucida and cumulus-oocyte complexes are disrupted. Oocytes of heterozygous females have a thin zona, but females are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts5 A G 16: 85,869,993 V537A possibly damaging Het
Adcy10 A T 1: 165,515,380 I272F possibly damaging Het
Adcy6 A G 15: 98,604,728 S2P probably damaging Het
Agap1 A G 1: 89,837,806 probably null Het
Aldh3a2 A G 11: 61,265,102 V116A probably benign Het
Ankdd1b A T 13: 96,433,405 probably null Het
Antxrl G A 14: 34,060,949 V233I probably damaging Het
Atp8b5 A G 4: 43,302,590 I38V probably benign Het
Atxn7l2 A G 3: 108,208,432 probably benign Het
Bfsp2 A T 9: 103,480,225 M1K probably null Het
Camsap3 T A 8: 3,603,968 I520N possibly damaging Het
Cenpc1 C T 5: 86,013,510 V854I possibly damaging Het
Csnk2a1 T C 2: 152,257,427 L88S probably damaging Het
Dcaf17 A G 2: 71,073,173 N171D probably damaging Het
Dctn1 G C 6: 83,197,508 A1077P possibly damaging Het
Dock1 T C 7: 134,851,609 probably benign Het
Egfr A T 11: 16,889,920 I645L probably benign Het
Gdpd1 T G 11: 87,059,509 K79N possibly damaging Het
Ggt5 A T 10: 75,609,908 L432F probably benign Het
Gm11060 A G 2: 105,093,752 T22A unknown Het
Gpr132 G A 12: 112,852,240 T322I possibly damaging Het
Grin1 G A 2: 25,292,430 R940* probably null Het
Hip1 T C 5: 135,438,632 T316A probably benign Het
Hnrnpm A G 17: 33,666,488 probably benign Het
Hsd3b5 G A 3: 98,619,530 T200I probably benign Het
Hspa9 A T 18: 34,938,606 L647H probably damaging Het
Itgad T C 7: 128,192,137 I727T probably benign Het
Kcnma1 T C 14: 23,463,200 D522G probably damaging Het
Lipf C T 19: 33,970,732 probably benign Het
Ly6i T C 15: 74,983,055 D2G possibly damaging Het
Mast1 G A 8: 84,920,635 P631L probably damaging Het
Mmp1b G C 9: 7,386,693 L144V probably damaging Het
Msh6 A G 17: 87,984,758 S314G probably benign Het
Myo5c G A 9: 75,263,066 V493I possibly damaging Het
Nefm A G 14: 68,121,379 L402P probably damaging Het
Nrxn2 T C 19: 6,481,446 F697S probably damaging Het
Olfr156 A T 4: 43,820,639 C241S probably damaging Het
Pex13 A G 11: 23,649,422 I363T probably benign Het
Plcb3 T C 19: 6,955,046 R1082G possibly damaging Het
Psg28 A T 7: 18,427,964 S205T possibly damaging Het
Pxt1 C A 17: 28,934,782 V26L possibly damaging Het
Ripk2 G A 4: 16,163,239 T53M probably damaging Het
Slc5a9 A G 4: 111,883,964 V495A probably benign Het
Snrpa T C 7: 27,192,937 K66R probably benign Het
Srgap1 T A 10: 121,896,738 E145V probably damaging Het
Suz12 A G 11: 80,032,113 T694A probably benign Het
Tatdn2 T A 6: 113,704,327 D440E probably benign Het
Tbc1d21 A G 9: 58,362,813 probably null Het
Tbc1d31 T A 15: 57,951,638 Y570* probably null Het
Tbc1d32 A T 10: 56,177,479 probably benign Het
Tdrd5 G C 1: 156,259,836 Q839E probably benign Het
Tecpr2 A G 12: 110,968,953 N1402S probably benign Het
Thbs1 A G 2: 118,122,672 D921G probably damaging Het
Tll1 A G 8: 64,038,490 V803A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trpm4 T C 7: 45,317,056 E461G probably damaging Het
Other mutations in Zp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02282:Zp3 APN 5 135984351 missense possibly damaging 0.72
IGL02563:Zp3 APN 5 135987610 critical splice donor site probably null
IGL03185:Zp3 APN 5 135982721 missense possibly damaging 0.94
PIT4280001:Zp3 UTSW 5 135984464 missense possibly damaging 0.56
R0646:Zp3 UTSW 5 135984356 missense possibly damaging 0.46
R1691:Zp3 UTSW 5 135980281 missense possibly damaging 0.86
R3415:Zp3 UTSW 5 135985660 missense probably benign 0.07
R4599:Zp3 UTSW 5 135984235 nonsense probably null
R4987:Zp3 UTSW 5 135987505 nonsense probably null
R5907:Zp3 UTSW 5 135988523 missense probably benign 0.00
R6388:Zp3 UTSW 5 135982694 missense probably benign 0.02
R6587:Zp3 UTSW 5 135987498 missense possibly damaging 0.68
R6629:Zp3 UTSW 5 135987336 missense probably benign 0.00
R7438:Zp3 UTSW 5 135982705 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGGGCCTAAGTTGATAGAGACC -3'
(R):5'- GGGAGCCGATTTCTCAGTATTCCAG -3'

Sequencing Primer
(F):5'- CTGTCAAGTGTAGGCACTCAG -3'
(R):5'- TCCAGTTCTCTGAAAGGGTACAG -3'
Posted On2014-03-14