Incidental Mutation 'R1454:Mmp1b'
ID162207
Institutional Source Beutler Lab
Gene Symbol Mmp1b
Ensembl Gene ENSMUSG00000041620
Gene Namematrix metallopeptidase 1b (interstitial collagenase)
SynonymsMcol-B
MMRRC Submission 039509-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R1454 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location7368239-7388047 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 7386693 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Valine at position 144 (L144V)
Ref Sequence ENSEMBL: ENSMUSP00000047261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047888]
Predicted Effect probably damaging
Transcript: ENSMUST00000047888
AA Change: L144V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047261
Gene: ENSMUSG00000041620
AA Change: L144V

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:PG_binding_1 26 84 1.4e-13 PFAM
ZnMc 102 260 3.08e-46 SMART
HX 281 323 4.39e-2 SMART
HX 325 369 3.51e-10 SMART
HX 374 421 1.03e-16 SMART
HX 423 463 1.6e0 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. This gene is located in a cluster of other matrix metalloproteinase genes on chromosome 9. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts5 A G 16: 85,869,993 V537A possibly damaging Het
Adcy10 A T 1: 165,515,380 I272F possibly damaging Het
Adcy6 A G 15: 98,604,728 S2P probably damaging Het
Agap1 A G 1: 89,837,806 probably null Het
Aldh3a2 A G 11: 61,265,102 V116A probably benign Het
Ankdd1b A T 13: 96,433,405 probably null Het
Antxrl G A 14: 34,060,949 V233I probably damaging Het
Atp8b5 A G 4: 43,302,590 I38V probably benign Het
Atxn7l2 A G 3: 108,208,432 probably benign Het
Bfsp2 A T 9: 103,480,225 M1K probably null Het
Camsap3 T A 8: 3,603,968 I520N possibly damaging Het
Cenpc1 C T 5: 86,013,510 V854I possibly damaging Het
Csnk2a1 T C 2: 152,257,427 L88S probably damaging Het
Dcaf17 A G 2: 71,073,173 N171D probably damaging Het
Dctn1 G C 6: 83,197,508 A1077P possibly damaging Het
Dock1 T C 7: 134,851,609 probably benign Het
Egfr A T 11: 16,889,920 I645L probably benign Het
Gdpd1 T G 11: 87,059,509 K79N possibly damaging Het
Ggt5 A T 10: 75,609,908 L432F probably benign Het
Gm11060 A G 2: 105,093,752 T22A unknown Het
Gpr132 G A 12: 112,852,240 T322I possibly damaging Het
Grin1 G A 2: 25,292,430 R940* probably null Het
Hip1 T C 5: 135,438,632 T316A probably benign Het
Hnrnpm A G 17: 33,666,488 probably benign Het
Hsd3b5 G A 3: 98,619,530 T200I probably benign Het
Hspa9 A T 18: 34,938,606 L647H probably damaging Het
Itgad T C 7: 128,192,137 I727T probably benign Het
Kcnma1 T C 14: 23,463,200 D522G probably damaging Het
Lipf C T 19: 33,970,732 probably benign Het
Ly6i T C 15: 74,983,055 D2G possibly damaging Het
Mast1 G A 8: 84,920,635 P631L probably damaging Het
Msh6 A G 17: 87,984,758 S314G probably benign Het
Myo5c G A 9: 75,263,066 V493I possibly damaging Het
Nefm A G 14: 68,121,379 L402P probably damaging Het
Nrxn2 T C 19: 6,481,446 F697S probably damaging Het
Olfr156 A T 4: 43,820,639 C241S probably damaging Het
Pex13 A G 11: 23,649,422 I363T probably benign Het
Plcb3 T C 19: 6,955,046 R1082G possibly damaging Het
Psg28 A T 7: 18,427,964 S205T possibly damaging Het
Pxt1 C A 17: 28,934,782 V26L possibly damaging Het
Ripk2 G A 4: 16,163,239 T53M probably damaging Het
Slc5a9 A G 4: 111,883,964 V495A probably benign Het
Snrpa T C 7: 27,192,937 K66R probably benign Het
Srgap1 T A 10: 121,896,738 E145V probably damaging Het
Suz12 A G 11: 80,032,113 T694A probably benign Het
Tatdn2 T A 6: 113,704,327 D440E probably benign Het
Tbc1d21 A G 9: 58,362,813 probably null Het
Tbc1d31 T A 15: 57,951,638 Y570* probably null Het
Tbc1d32 A T 10: 56,177,479 probably benign Het
Tdrd5 G C 1: 156,259,836 Q839E probably benign Het
Tecpr2 A G 12: 110,968,953 N1402S probably benign Het
Thbs1 A G 2: 118,122,672 D921G probably damaging Het
Tll1 A G 8: 64,038,490 V803A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trpm4 T C 7: 45,317,056 E461G probably damaging Het
Zp3 T A 5: 135,984,188 I152N probably damaging Het
Other mutations in Mmp1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Mmp1b APN 9 7387946 missense probably benign 0.00
IGL00339:Mmp1b APN 9 7368304 missense probably benign 0.19
IGL00832:Mmp1b APN 9 7387023 missense possibly damaging 0.81
IGL01110:Mmp1b APN 9 7384921 missense probably benign 0.02
IGL02121:Mmp1b APN 9 7384935 missense probably benign 0.22
IGL02143:Mmp1b APN 9 7386400 missense probably benign 0.10
IGL02698:Mmp1b APN 9 7384877 missense probably damaging 1.00
IGL02928:Mmp1b APN 9 7368242 makesense probably null
IGL03218:Mmp1b APN 9 7387907 missense probably benign 0.07
IGL03304:Mmp1b APN 9 7384701 missense probably damaging 1.00
IGL02802:Mmp1b UTSW 9 7384709 missense probably benign 0.08
R0122:Mmp1b UTSW 9 7386689 missense probably damaging 0.99
R0506:Mmp1b UTSW 9 7387013 missense possibly damaging 0.52
R0600:Mmp1b UTSW 9 7387947 missense possibly damaging 0.55
R1466:Mmp1b UTSW 9 7384779 splice site probably benign
R1696:Mmp1b UTSW 9 7386699 missense probably damaging 0.99
R1837:Mmp1b UTSW 9 7386409 missense probably damaging 1.00
R1986:Mmp1b UTSW 9 7368577 missense probably benign 0.01
R2031:Mmp1b UTSW 9 7368607 missense possibly damaging 0.68
R2098:Mmp1b UTSW 9 7386984 missense probably benign 0.03
R2107:Mmp1b UTSW 9 7369310 missense probably damaging 1.00
R2847:Mmp1b UTSW 9 7370763 missense probably benign 0.05
R2870:Mmp1b UTSW 9 7386875 synonymous silent
R3944:Mmp1b UTSW 9 7384708 missense possibly damaging 0.73
R4654:Mmp1b UTSW 9 7370849 missense probably benign 0.18
R4829:Mmp1b UTSW 9 7370729 critical splice donor site probably null
R5329:Mmp1b UTSW 9 7384897 missense possibly damaging 0.61
R5332:Mmp1b UTSW 9 7384897 missense possibly damaging 0.61
R5333:Mmp1b UTSW 9 7384897 missense possibly damaging 0.61
R5418:Mmp1b UTSW 9 7384897 missense possibly damaging 0.61
R5419:Mmp1b UTSW 9 7384897 missense possibly damaging 0.61
R5420:Mmp1b UTSW 9 7384897 missense possibly damaging 0.61
R6053:Mmp1b UTSW 9 7385031 missense probably benign 0.07
R6394:Mmp1b UTSW 9 7386316 missense probably benign 0.20
R6774:Mmp1b UTSW 9 7387914 missense probably benign 0.00
R6842:Mmp1b UTSW 9 7384888 missense probably damaging 1.00
R7092:Mmp1b UTSW 9 7386981 missense probably damaging 1.00
R7146:Mmp1b UTSW 9 7385014 missense probably damaging 1.00
R7549:Mmp1b UTSW 9 7384753 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- ACTGTGAGAGGCAATGTGAGTCAAC -3'
(R):5'- ACCCTGAGAGCTATGAAGAAGCCC -3'

Sequencing Primer
(F):5'- GGCAATGTGAGTCAACTTACC -3'
(R):5'- TGATGTGGCCCCATATGC -3'
Posted On2014-03-14