Incidental Mutation 'R1454:Ggt5'
ID162212
Institutional Source Beutler Lab
Gene Symbol Ggt5
Ensembl Gene ENSMUSG00000006344
Gene Namegamma-glutamyltransferase 5
SynonymsGGL, Ggtla1, GGT-REL, gamma-glutamyl leukotrienase
MMRRC Submission 039509-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1454 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location75589340-75617200 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 75609908 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 432 (L432F)
Ref Sequence ENSEMBL: ENSMUSP00000072074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072217] [ENSMUST00000189972] [ENSMUST00000218807]
Predicted Effect probably benign
Transcript: ENSMUST00000072217
AA Change: L432F

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000072074
Gene: ENSMUSG00000006344
AA Change: L432F

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:G_glu_transpept 58 568 1.6e-164 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188444
Predicted Effect probably benign
Transcript: ENSMUST00000189972
SMART Domains Protein: ENSMUSP00000139459
Gene: ENSMUSG00000006344

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189991
Predicted Effect probably benign
Transcript: ENSMUST00000218807
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219214
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219247
Meta Mutation Damage Score 0.11 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the gamma-glutamyl transpeptidase gene family, and some reports indicate that it is capable of cleaving the gamma-glutamyl moiety of glutathione. The protein encoded by this gene is synthesized as a single, catalytically-inactive polypeptide, that is processed post-transcriptionally to form a heavy and light subunit, with the catalytic activity contained within the small subunit. The encoded enzyme is able to convert leukotriene C4 to leukotriene D4, but appears to have distinct substrate specificity compared to gamma-glutamyl transpeptidase. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygous mutants show an attenuation in neutrophil recruitment in an experimental model of peritonitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts5 A G 16: 85,869,993 V537A possibly damaging Het
Adcy10 A T 1: 165,515,380 I272F possibly damaging Het
Adcy6 A G 15: 98,604,728 S2P probably damaging Het
Agap1 A G 1: 89,837,806 probably null Het
Aldh3a2 A G 11: 61,265,102 V116A probably benign Het
Ankdd1b A T 13: 96,433,405 probably null Het
Antxrl G A 14: 34,060,949 V233I probably damaging Het
Atp8b5 A G 4: 43,302,590 I38V probably benign Het
Atxn7l2 A G 3: 108,208,432 probably benign Het
Bfsp2 A T 9: 103,480,225 M1K probably null Het
Camsap3 T A 8: 3,603,968 I520N possibly damaging Het
Cenpc1 C T 5: 86,013,510 V854I possibly damaging Het
Csnk2a1 T C 2: 152,257,427 L88S probably damaging Het
Dcaf17 A G 2: 71,073,173 N171D probably damaging Het
Dctn1 G C 6: 83,197,508 A1077P possibly damaging Het
Dock1 T C 7: 134,851,609 probably benign Het
Egfr A T 11: 16,889,920 I645L probably benign Het
Gdpd1 T G 11: 87,059,509 K79N possibly damaging Het
Gm11060 A G 2: 105,093,752 T22A unknown Het
Gpr132 G A 12: 112,852,240 T322I possibly damaging Het
Grin1 G A 2: 25,292,430 R940* probably null Het
Hip1 T C 5: 135,438,632 T316A probably benign Het
Hnrnpm A G 17: 33,666,488 probably benign Het
Hsd3b5 G A 3: 98,619,530 T200I probably benign Het
Hspa9 A T 18: 34,938,606 L647H probably damaging Het
Itgad T C 7: 128,192,137 I727T probably benign Het
Kcnma1 T C 14: 23,463,200 D522G probably damaging Het
Lipf C T 19: 33,970,732 probably benign Het
Ly6i T C 15: 74,983,055 D2G possibly damaging Het
Mast1 G A 8: 84,920,635 P631L probably damaging Het
Mmp1b G C 9: 7,386,693 L144V probably damaging Het
Msh6 A G 17: 87,984,758 S314G probably benign Het
Myo5c G A 9: 75,263,066 V493I possibly damaging Het
Nefm A G 14: 68,121,379 L402P probably damaging Het
Nrxn2 T C 19: 6,481,446 F697S probably damaging Het
Olfr156 A T 4: 43,820,639 C241S probably damaging Het
Pex13 A G 11: 23,649,422 I363T probably benign Het
Plcb3 T C 19: 6,955,046 R1082G possibly damaging Het
Psg28 A T 7: 18,427,964 S205T possibly damaging Het
Pxt1 C A 17: 28,934,782 V26L possibly damaging Het
Ripk2 G A 4: 16,163,239 T53M probably damaging Het
Slc5a9 A G 4: 111,883,964 V495A probably benign Het
Snrpa T C 7: 27,192,937 K66R probably benign Het
Srgap1 T A 10: 121,896,738 E145V probably damaging Het
Suz12 A G 11: 80,032,113 T694A probably benign Het
Tatdn2 T A 6: 113,704,327 D440E probably benign Het
Tbc1d21 A G 9: 58,362,813 probably null Het
Tbc1d31 T A 15: 57,951,638 Y570* probably null Het
Tbc1d32 A T 10: 56,177,479 probably benign Het
Tdrd5 G C 1: 156,259,836 Q839E probably benign Het
Tecpr2 A G 12: 110,968,953 N1402S probably benign Het
Thbs1 A G 2: 118,122,672 D921G probably damaging Het
Tll1 A G 8: 64,038,490 V803A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trpm4 T C 7: 45,317,056 E461G probably damaging Het
Zp3 T A 5: 135,984,188 I152N probably damaging Het
Other mutations in Ggt5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01503:Ggt5 APN 10 75610110 splice site probably benign
IGL01926:Ggt5 APN 10 75604101 missense probably benign 0.00
IGL02095:Ggt5 APN 10 75608803 missense probably benign 0.01
IGL02252:Ggt5 APN 10 75602732 missense possibly damaging 0.51
IGL02393:Ggt5 APN 10 75610237 splice site probably benign
IGL02515:Ggt5 APN 10 75589770 missense probably benign 0.23
IGL02528:Ggt5 APN 10 75610420 splice site probably benign
IGL02964:Ggt5 APN 10 75604128 missense probably benign 0.08
R0646:Ggt5 UTSW 10 75602648 missense probably damaging 0.99
R0834:Ggt5 UTSW 10 75604770 missense possibly damaging 0.73
R1650:Ggt5 UTSW 10 75604761 missense probably benign 0.00
R1846:Ggt5 UTSW 10 75610542 splice site probably null
R1896:Ggt5 UTSW 10 75604726 missense probably damaging 1.00
R2044:Ggt5 UTSW 10 75604087 missense probably damaging 0.97
R2357:Ggt5 UTSW 10 75609241 missense probably benign 0.19
R3151:Ggt5 UTSW 10 75609242 missense probably benign 0.35
R4667:Ggt5 UTSW 10 75603031 missense probably damaging 1.00
R4669:Ggt5 UTSW 10 75603031 missense probably damaging 1.00
R5060:Ggt5 UTSW 10 75604774 missense probably benign
R5756:Ggt5 UTSW 10 75604773 missense probably benign
R6156:Ggt5 UTSW 10 75609326 missense probably damaging 1.00
R6162:Ggt5 UTSW 10 75589792 missense possibly damaging 0.92
R6900:Ggt5 UTSW 10 75610537 missense possibly damaging 0.81
Z1088:Ggt5 UTSW 10 75608759 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TCCCTCGCTGAGGAAAGCTATTGC -3'
(R):5'- CCCTGGCCTTTGTTGACCAAGATG -3'

Sequencing Primer
(F):5'- aaaaaaaaaaaaaaaaaGATGGGGGG -3'
(R):5'- CTTTGTTGACCAAGATGGAAGG -3'
Posted On2014-03-14