Incidental Mutation 'R1426:Zyg11b'
ID162242
Institutional Source Beutler Lab
Gene Symbol Zyg11b
Ensembl Gene ENSMUSG00000034636
Gene Namezyg-ll family member B, cell cycle regulator
Synonyms1110046I03Rik, LOC242610, 2810482G21Rik, D4Mgi23
MMRRC Submission 039482-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.691) question?
Stock #R1426 (G1)
Quality Score204
Status Validated
Chromosome4
Chromosomal Location108229724-108301096 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 108250812 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 466 (R466C)
Ref Sequence ENSEMBL: ENSMUSP00000043844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043616]
Predicted Effect probably damaging
Transcript: ENSMUST00000043616
AA Change: R466C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000043844
Gene: ENSMUSG00000034636
AA Change: R466C

DomainStartEndE-ValueType
SCOP:d1jdha_ 370 722 3e-16 SMART
Blast:ARM 480 526 1e-17 BLAST
Blast:ARM 528 570 3e-19 BLAST
Blast:ARM 638 679 3e-10 BLAST
Meta Mutation Damage Score 0.03 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.3%
  • 20x: 86.1%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,324,435 V214E probably damaging Het
Adh1 A G 3: 138,286,795 D224G probably damaging Het
Arhgap28 C A 17: 67,857,464 Q554H probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Brat1 G A 5: 140,718,013 V674I probably benign Het
Brd2 ATCTTCTTC ATCTTC 17: 34,114,007 probably benign Het
Ccdc162 T C 10: 41,553,182 D438G possibly damaging Het
Cyp4x1 T A 4: 115,112,791 probably benign Het
Dip2a T C 10: 76,279,820 probably benign Het
Eif2s1 A G 12: 78,881,168 D206G probably benign Het
Elovl7 T A 13: 108,282,494 I220N possibly damaging Het
Gsto1 A G 19: 47,857,942 E76G probably damaging Het
Hspa14 A T 2: 3,508,821 W12R probably damaging Het
L3mbtl2 T A 15: 81,676,317 C260S possibly damaging Het
Lama3 G T 18: 12,481,098 probably null Het
Lrrc34 T A 3: 30,643,579 probably benign Het
Lrrc45 A T 11: 120,720,013 Q525L probably benign Het
Lss T C 10: 76,536,303 I164T probably damaging Het
Myh11 T A 16: 14,205,931 K1527* probably null Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Ncoa1 T A 12: 4,270,737 probably benign Het
Olfr262 G T 19: 12,241,182 Q160K possibly damaging Het
Olfr768 A T 10: 129,093,690 C95S probably damaging Het
Pafah1b3 T C 7: 25,297,135 E41G possibly damaging Het
Pnmal1 C T 7: 16,960,984 P255S possibly damaging Het
Prkar2b A T 12: 31,962,988 probably benign Het
Rbck1 A T 2: 152,327,241 probably benign Het
Rcor2 A G 19: 7,271,030 S137G possibly damaging Het
Slc25a48 T A 13: 56,448,991 probably benign Het
Slc7a4 A G 16: 17,573,944 probably null Het
Tert T C 13: 73,642,353 probably benign Het
Traf7 A T 17: 24,511,681 I344N probably damaging Het
Vmn1r194 T A 13: 22,245,066 F284L probably damaging Het
Xpc A G 6: 91,493,238 M699T probably damaging Het
Zbtb5 T C 4: 44,993,968 H472R possibly damaging Het
Zfp786 A G 6: 47,825,079 V88A probably benign Het
Zkscan7 T C 9: 122,895,163 I399T probably benign Het
Other mutations in Zyg11b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01080:Zyg11b APN 4 108237416 missense probably damaging 1.00
IGL01143:Zyg11b APN 4 108244994 missense possibly damaging 0.69
IGL01627:Zyg11b APN 4 108250788 missense probably benign 0.19
IGL02517:Zyg11b APN 4 108266318 missense probably damaging 0.96
IGL03166:Zyg11b APN 4 108265889 missense probably benign 0.32
R0326:Zyg11b UTSW 4 108272253 missense possibly damaging 0.77
R0345:Zyg11b UTSW 4 108266407 missense probably damaging 1.00
R0396:Zyg11b UTSW 4 108255308 missense probably damaging 1.00
R0571:Zyg11b UTSW 4 108260042 missense probably damaging 1.00
R0718:Zyg11b UTSW 4 108242076 missense possibly damaging 0.94
R1495:Zyg11b UTSW 4 108266213 missense probably damaging 1.00
R1829:Zyg11b UTSW 4 108266093 missense possibly damaging 0.65
R1907:Zyg11b UTSW 4 108255226 missense probably damaging 1.00
R1916:Zyg11b UTSW 4 108272283 missense probably damaging 0.99
R1980:Zyg11b UTSW 4 108265930 missense probably damaging 0.99
R2070:Zyg11b UTSW 4 108250819 missense possibly damaging 0.73
R2495:Zyg11b UTSW 4 108244724 critical splice donor site probably null
R4717:Zyg11b UTSW 4 108241872 missense probably damaging 0.99
R5889:Zyg11b UTSW 4 108237380 nonsense probably null
R5957:Zyg11b UTSW 4 108245013 missense probably damaging 1.00
R6606:Zyg11b UTSW 4 108236089 missense probably benign 0.00
R7151:Zyg11b UTSW 4 108244922 missense possibly damaging 0.49
R7316:Zyg11b UTSW 4 108250502 missense possibly damaging 0.81
R7488:Zyg11b UTSW 4 108266458 missense possibly damaging 0.65
X0022:Zyg11b UTSW 4 108236101 missense probably benign
X0067:Zyg11b UTSW 4 108255346 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAAGGGCCAGTAAACTTACCCTGAC -3'
(R):5'- GTCCCAAGTTGCACCATCGACC -3'

Sequencing Primer
(F):5'- TGAGTTTACTACAGACTGCCG -3'
(R):5'- CCACATCTGGCTCCCTGAAG -3'
Posted On2014-03-14