Incidental Mutation 'R1426:Cyp4x1'
ID162243
Institutional Source Beutler Lab
Gene Symbol Cyp4x1
Ensembl Gene ENSMUSG00000047155
Gene Namecytochrome P450, family 4, subfamily x, polypeptide 1
SynonymsCyp4a28-ps
MMRRC Submission 039482-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R1426 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location115106323-115134281 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 115112791 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051400] [ENSMUST00000106545]
Predicted Effect probably benign
Transcript: ENSMUST00000051400
SMART Domains Protein: ENSMUSP00000059545
Gene: ENSMUSG00000047155

DomainStartEndE-ValueType
transmembrane domain 13 30 N/A INTRINSIC
low complexity region 32 43 N/A INTRINSIC
Pfam:p450 46 501 1.5e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106545
SMART Domains Protein: ENSMUSP00000102155
Gene: ENSMUSG00000047155

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
Pfam:p450 20 475 4.7e-118 PFAM
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.3%
  • 20x: 86.1%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes and is located within a cluster of genes belonging to this superfamily on chromosome 1. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. The expression pattern of a similar rat protein suggests that this protein may be involved in neurovascular function in the brain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,324,435 V214E probably damaging Het
Adh1 A G 3: 138,286,795 D224G probably damaging Het
Arhgap28 C A 17: 67,857,464 Q554H probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Brat1 G A 5: 140,718,013 V674I probably benign Het
Brd2 ATCTTCTTC ATCTTC 17: 34,114,007 probably benign Het
Ccdc162 T C 10: 41,553,182 D438G possibly damaging Het
Dip2a T C 10: 76,279,820 probably benign Het
Eif2s1 A G 12: 78,881,168 D206G probably benign Het
Elovl7 T A 13: 108,282,494 I220N possibly damaging Het
Gsto1 A G 19: 47,857,942 E76G probably damaging Het
Hspa14 A T 2: 3,508,821 W12R probably damaging Het
L3mbtl2 T A 15: 81,676,317 C260S possibly damaging Het
Lama3 G T 18: 12,481,098 probably null Het
Lrrc34 T A 3: 30,643,579 probably benign Het
Lrrc45 A T 11: 120,720,013 Q525L probably benign Het
Lss T C 10: 76,536,303 I164T probably damaging Het
Myh11 T A 16: 14,205,931 K1527* probably null Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Ncoa1 T A 12: 4,270,737 probably benign Het
Olfr262 G T 19: 12,241,182 Q160K possibly damaging Het
Olfr768 A T 10: 129,093,690 C95S probably damaging Het
Pafah1b3 T C 7: 25,297,135 E41G possibly damaging Het
Pnmal1 C T 7: 16,960,984 P255S possibly damaging Het
Prkar2b A T 12: 31,962,988 probably benign Het
Rbck1 A T 2: 152,327,241 probably benign Het
Rcor2 A G 19: 7,271,030 S137G possibly damaging Het
Slc25a48 T A 13: 56,448,991 probably benign Het
Slc7a4 A G 16: 17,573,944 probably null Het
Tert T C 13: 73,642,353 probably benign Het
Traf7 A T 17: 24,511,681 I344N probably damaging Het
Vmn1r194 T A 13: 22,245,066 F284L probably damaging Het
Xpc A G 6: 91,493,238 M699T probably damaging Het
Zbtb5 T C 4: 44,993,968 H472R possibly damaging Het
Zfp786 A G 6: 47,825,079 V88A probably benign Het
Zkscan7 T C 9: 122,895,163 I399T probably benign Het
Zyg11b G A 4: 108,250,812 R466C probably damaging Het
Other mutations in Cyp4x1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Cyp4x1 APN 4 115121948 missense probably benign 0.00
IGL00913:Cyp4x1 APN 4 115112863 missense probably benign 0.19
IGL02990:Cyp4x1 APN 4 115121749 missense probably benign 0.02
IGL03411:Cyp4x1 APN 4 115108785 missense probably benign 0.05
R0607:Cyp4x1 UTSW 4 115112826 missense probably damaging 1.00
R1148:Cyp4x1 UTSW 4 115126555 splice site probably benign
R1148:Cyp4x1 UTSW 4 115126555 splice site probably benign
R1484:Cyp4x1 UTSW 4 115112901 missense probably damaging 1.00
R1675:Cyp4x1 UTSW 4 115127560 missense possibly damaging 0.94
R1718:Cyp4x1 UTSW 4 115111670 missense possibly damaging 0.75
R2208:Cyp4x1 UTSW 4 115126594 missense probably benign 0.01
R2325:Cyp4x1 UTSW 4 115124379 missense probably benign 0.40
R4223:Cyp4x1 UTSW 4 115112880 missense probably damaging 0.98
R4588:Cyp4x1 UTSW 4 115108797 missense probably damaging 1.00
R4717:Cyp4x1 UTSW 4 115121705 missense probably benign 0.02
R5522:Cyp4x1 UTSW 4 115121977 missense probably damaging 1.00
R5880:Cyp4x1 UTSW 4 115108721 missense possibly damaging 0.62
R5994:Cyp4x1 UTSW 4 115121945 missense probably benign
R6103:Cyp4x1 UTSW 4 115111667 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTAAAGCACAGTGAAAGAGTGCC -3'
(R):5'- CTCCTTTGTCCTTACAGGGAACAGC -3'

Sequencing Primer
(F):5'- GGCTGGAACCTAATAGCTCTC -3'
(R):5'- GCTGGATGAGATGTCATACACC -3'
Posted On2014-03-14