Incidental Mutation 'R1426:Brat1'
ID162244
Institutional Source Beutler Lab
Gene Symbol Brat1
Ensembl Gene ENSMUSG00000000148
Gene NameBRCA1-associated ATM activator 1
Synonyms
MMRRC Submission 039482-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #R1426 (G1)
Quality Score215
Status Validated
Chromosome5
Chromosomal Location140705011-140719379 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 140718013 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 674 (V674I)
Ref Sequence ENSEMBL: ENSMUSP00000098074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041588] [ENSMUST00000100505] [ENSMUST00000110806] [ENSMUST00000153440]
Predicted Effect probably benign
Transcript: ENSMUST00000041588
AA Change: V629I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000036016
Gene: ENSMUSG00000000148
AA Change: V629I

DomainStartEndE-ValueType
low complexity region 90 105 N/A INTRINSIC
low complexity region 402 413 N/A INTRINSIC
low complexity region 443 454 N/A INTRINSIC
low complexity region 486 498 N/A INTRINSIC
Pfam:HEAT 501 531 3e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100505
AA Change: V674I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000098074
Gene: ENSMUSG00000000148
AA Change: V674I

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
low complexity region 135 150 N/A INTRINSIC
low complexity region 447 458 N/A INTRINSIC
low complexity region 488 499 N/A INTRINSIC
low complexity region 531 543 N/A INTRINSIC
Pfam:HEAT 546 576 4.4e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110806
SMART Domains Protein: ENSMUSP00000106429
Gene: ENSMUSG00000000148

DomainStartEndE-ValueType
low complexity region 90 105 N/A INTRINSIC
low complexity region 402 413 N/A INTRINSIC
low complexity region 443 454 N/A INTRINSIC
low complexity region 486 498 N/A INTRINSIC
Pfam:HEAT 501 531 4.2e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124892
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131905
Predicted Effect probably benign
Transcript: ENSMUST00000153440
SMART Domains Protein: ENSMUSP00000114216
Gene: ENSMUSG00000000148

DomainStartEndE-ValueType
SCOP:d1gw5a_ 2 172 2e-3 SMART
Meta Mutation Damage Score 0.1636 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.3%
  • 20x: 86.1%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: A similar gene in human encodes a Breast Cancer 1 (BRCA1) interacting protein that is involved in cell cycle checkpoint signaling. The similar human protein is localized to DNA double strand breaks caused by ionizing radiation, and regulates cellular DNA damage response through interactions with Ataxia Telangiectasia Mutated (ATM) and DNA-dependent Protein Kinase. A pseudogene of this gene is located on chromosome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,324,435 V214E probably damaging Het
Adh1 A G 3: 138,286,795 D224G probably damaging Het
Arhgap28 C A 17: 67,857,464 Q554H probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Brd2 ATCTTCTTC ATCTTC 17: 34,114,007 probably benign Het
Ccdc162 T C 10: 41,553,182 D438G possibly damaging Het
Cyp4x1 T A 4: 115,112,791 probably benign Het
Dip2a T C 10: 76,279,820 probably benign Het
Eif2s1 A G 12: 78,881,168 D206G probably benign Het
Elovl7 T A 13: 108,282,494 I220N possibly damaging Het
Gsto1 A G 19: 47,857,942 E76G probably damaging Het
Hspa14 A T 2: 3,508,821 W12R probably damaging Het
L3mbtl2 T A 15: 81,676,317 C260S possibly damaging Het
Lama3 G T 18: 12,481,098 probably null Het
Lrrc34 T A 3: 30,643,579 probably benign Het
Lrrc45 A T 11: 120,720,013 Q525L probably benign Het
Lss T C 10: 76,536,303 I164T probably damaging Het
Myh11 T A 16: 14,205,931 K1527* probably null Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Ncoa1 T A 12: 4,270,737 probably benign Het
Olfr262 G T 19: 12,241,182 Q160K possibly damaging Het
Olfr768 A T 10: 129,093,690 C95S probably damaging Het
Pafah1b3 T C 7: 25,297,135 E41G possibly damaging Het
Pnmal1 C T 7: 16,960,984 P255S possibly damaging Het
Prkar2b A T 12: 31,962,988 probably benign Het
Rbck1 A T 2: 152,327,241 probably benign Het
Rcor2 A G 19: 7,271,030 S137G possibly damaging Het
Slc25a48 T A 13: 56,448,991 probably benign Het
Slc7a4 A G 16: 17,573,944 probably null Het
Tert T C 13: 73,642,353 probably benign Het
Traf7 A T 17: 24,511,681 I344N probably damaging Het
Vmn1r194 T A 13: 22,245,066 F284L probably damaging Het
Xpc A G 6: 91,493,238 M699T probably damaging Het
Zbtb5 T C 4: 44,993,968 H472R possibly damaging Het
Zfp786 A G 6: 47,825,079 V88A probably benign Het
Zkscan7 T C 9: 122,895,163 I399T probably benign Het
Zyg11b G A 4: 108,250,812 R466C probably damaging Het
Other mutations in Brat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Brat1 APN 5 140717177 missense probably damaging 1.00
IGL01327:Brat1 APN 5 140718208 nonsense probably null
IGL01897:Brat1 APN 5 140717915 missense probably benign 0.00
IGL01965:Brat1 APN 5 140718056 missense probably benign 0.01
IGL02437:Brat1 APN 5 140712808 missense possibly damaging 0.91
IGL03350:Brat1 APN 5 140705995 missense probably damaging 1.00
R0394:Brat1 UTSW 5 140718386 missense probably damaging 1.00
R1256:Brat1 UTSW 5 140710207 missense possibly damaging 0.87
R1474:Brat1 UTSW 5 140712627 missense probably benign
R1848:Brat1 UTSW 5 140718509 missense possibly damaging 0.94
R2205:Brat1 UTSW 5 140705133 intron probably benign
R3901:Brat1 UTSW 5 140717996 missense possibly damaging 0.77
R3902:Brat1 UTSW 5 140717996 missense possibly damaging 0.77
R4467:Brat1 UTSW 5 140705071 utr 5 prime probably benign
R4751:Brat1 UTSW 5 140718296 missense probably damaging 1.00
R5795:Brat1 UTSW 5 140713072 missense probably benign 0.01
R6151:Brat1 UTSW 5 140705961 missense probably benign 0.00
R7162:Brat1 UTSW 5 140710249 missense probably benign 0.00
X0026:Brat1 UTSW 5 140714938 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCCTAGATGCTCTATCACGGTCAC -3'
(R):5'- CGGCAGAGAGTCTGCAAGAATTCC -3'

Sequencing Primer
(F):5'- TCTATCACGGTCACTCAGAGG -3'
(R):5'- AGTCTGCAAGAATTCCGGGTG -3'
Posted On2014-03-14