Incidental Mutation 'R1426:Xpc'
ID162246
Institutional Source Beutler Lab
Gene Symbol Xpc
Ensembl Gene ENSMUSG00000030094
Gene Namexeroderma pigmentosum, complementation group C
Synonyms
MMRRC Submission 039482-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.339) question?
Stock #R1426 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location91489305-91515888 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91493238 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 699 (M699T)
Ref Sequence ENSEMBL: ENSMUSP00000032182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032182] [ENSMUST00000032183]
Predicted Effect probably damaging
Transcript: ENSMUST00000032182
AA Change: M699T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032182
Gene: ENSMUSG00000030094
AA Change: M699T

DomainStartEndE-ValueType
low complexity region 69 82 N/A INTRINSIC
low complexity region 106 115 N/A INTRINSIC
low complexity region 118 142 N/A INTRINSIC
low complexity region 299 315 N/A INTRINSIC
low complexity region 335 352 N/A INTRINSIC
low complexity region 371 387 N/A INTRINSIC
low complexity region 425 439 N/A INTRINSIC
Pfam:Rad4 485 619 6.4e-26 PFAM
BHD_1 623 675 4.09e-25 SMART
BHD_2 677 737 4.96e-24 SMART
BHD_3 744 818 4.83e-45 SMART
low complexity region 826 835 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000032183
SMART Domains Protein: ENSMUSP00000032183
Gene: ENSMUSG00000030095

DomainStartEndE-ValueType
transmembrane domain 32 51 N/A INTRINSIC
Pfam:DUF1625 121 373 3.6e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150279
Meta Mutation Damage Score 0.31 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.3%
  • 20x: 86.1%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the nucleotide excision repair (NER) pathway. There are multiple components involved in the NER pathway, including Xeroderma pigmentosum (XP) A-G and V, Cockayne syndrome (CS) A and B, and trichothiodystrophy (TTD) group A, etc. This component, XPC, plays an important role in the early steps of global genome NER, especially in damage recognition, open complex formation, and repair protein complex formation. Mutations in this gene or some other NER components result in Xeroderma pigmentosum, a rare autosomal recessive disorder characterized by increased sensitivity to sunlight with the development of carcinomas at an early age. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous mutants are highly susceptible to ultraviolet-induced skin tumors and exhibit a 30-fold higher somatic frequency of gene mutations at one year of age. Mutant cells exhibit impaired nucleotide excision repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,324,435 V214E probably damaging Het
Adh1 A G 3: 138,286,795 D224G probably damaging Het
Arhgap28 C A 17: 67,857,464 Q554H probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Brat1 G A 5: 140,718,013 V674I probably benign Het
Brd2 ATCTTCTTC ATCTTC 17: 34,114,007 probably benign Het
Ccdc162 T C 10: 41,553,182 D438G possibly damaging Het
Cyp4x1 T A 4: 115,112,791 probably benign Het
Dip2a T C 10: 76,279,820 probably benign Het
Eif2s1 A G 12: 78,881,168 D206G probably benign Het
Elovl7 T A 13: 108,282,494 I220N possibly damaging Het
Gsto1 A G 19: 47,857,942 E76G probably damaging Het
Hspa14 A T 2: 3,508,821 W12R probably damaging Het
L3mbtl2 T A 15: 81,676,317 C260S possibly damaging Het
Lama3 G T 18: 12,481,098 probably null Het
Lrrc34 T A 3: 30,643,579 probably benign Het
Lrrc45 A T 11: 120,720,013 Q525L probably benign Het
Lss T C 10: 76,536,303 I164T probably damaging Het
Myh11 T A 16: 14,205,931 K1527* probably null Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Ncoa1 T A 12: 4,270,737 probably benign Het
Olfr262 G T 19: 12,241,182 Q160K possibly damaging Het
Olfr768 A T 10: 129,093,690 C95S probably damaging Het
Pafah1b3 T C 7: 25,297,135 E41G possibly damaging Het
Pnmal1 C T 7: 16,960,984 P255S possibly damaging Het
Prkar2b A T 12: 31,962,988 probably benign Het
Rbck1 A T 2: 152,327,241 probably benign Het
Rcor2 A G 19: 7,271,030 S137G possibly damaging Het
Slc25a48 T A 13: 56,448,991 probably benign Het
Slc7a4 A G 16: 17,573,944 probably null Het
Tert T C 13: 73,642,353 probably benign Het
Traf7 A T 17: 24,511,681 I344N probably damaging Het
Vmn1r194 T A 13: 22,245,066 F284L probably damaging Het
Zbtb5 T C 4: 44,993,968 H472R possibly damaging Het
Zfp786 A G 6: 47,825,079 V88A probably benign Het
Zkscan7 T C 9: 122,895,163 I399T probably benign Het
Zyg11b G A 4: 108,250,812 R466C probably damaging Het
Other mutations in Xpc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Xpc APN 6 91492264 unclassified probably benign
IGL01108:Xpc APN 6 91493005 missense probably damaging 1.00
IGL01310:Xpc APN 6 91490107 missense probably benign 0.02
IGL01323:Xpc APN 6 91492353 missense probably damaging 1.00
IGL01350:Xpc APN 6 91500011 missense probably benign 0.01
IGL01656:Xpc APN 6 91505467 missense probably damaging 0.98
IGL01922:Xpc APN 6 91505425 missense probably damaging 1.00
IGL02412:Xpc APN 6 91499785 missense probably benign 0.01
IGL02448:Xpc APN 6 91515744 missense probably benign 0.00
IGL02571:Xpc APN 6 91504071 missense probably benign 0.00
IGL02937:Xpc APN 6 91500137 missense probably damaging 1.00
IGL02951:Xpc APN 6 91506849 missense probably damaging 1.00
IGL03033:Xpc APN 6 91491315 splice site probably null
IGL03248:Xpc APN 6 91504583 missense probably damaging 0.99
IGL03046:Xpc UTSW 6 91510481 missense probably damaging 1.00
R0031:Xpc UTSW 6 91491226 missense probably benign 0.01
R0173:Xpc UTSW 6 91504735 unclassified probably benign
R0285:Xpc UTSW 6 91498064 missense probably damaging 0.99
R0454:Xpc UTSW 6 91491226 missense probably benign 0.01
R0535:Xpc UTSW 6 91504578 missense possibly damaging 0.92
R0554:Xpc UTSW 6 91491226 missense probably benign 0.01
R0759:Xpc UTSW 6 91498142 missense probably damaging 0.99
R1478:Xpc UTSW 6 91508528 missense possibly damaging 0.94
R1676:Xpc UTSW 6 91492947 missense possibly damaging 0.56
R1969:Xpc UTSW 6 91501025 splice site probably null
R2138:Xpc UTSW 6 91498122 nonsense probably null
R2237:Xpc UTSW 6 91498108 missense probably damaging 1.00
R4580:Xpc UTSW 6 91500011 missense probably benign 0.01
R5318:Xpc UTSW 6 91493010 missense probably damaging 1.00
R5567:Xpc UTSW 6 91498135 missense probably damaging 1.00
R5681:Xpc UTSW 6 91504120 missense probably damaging 1.00
R6022:Xpc UTSW 6 91499636 missense probably damaging 0.96
R6791:Xpc UTSW 6 91506857 missense probably benign 0.01
R6794:Xpc UTSW 6 91506857 missense probably benign 0.01
R6983:Xpc UTSW 6 91504023 missense probably damaging 0.99
R7214:Xpc UTSW 6 91492338 missense probably damaging 1.00
R7442:Xpc UTSW 6 91504649 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTACACGTTCCCAAACTCATTCCG -3'
(R):5'- GAGCAAAGGTCTGCTTCACCTCTC -3'

Sequencing Primer
(F):5'- AGcccactctgaccccc -3'
(R):5'- gtctgcttcaCCTCTCTCACAG -3'
Posted On2014-03-14