Incidental Mutation 'R1426:Lss'
ID162251
Institutional Source Beutler Lab
Gene Symbol Lss
Ensembl Gene ENSMUSG00000033105
Gene Namelanosterol synthase
Synonyms2810025N20Rik, Osc, D10Ertd116e
MMRRC Submission 039482-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1426 (G1)
Quality Score221
Status Validated
Chromosome10
Chromosomal Location76531588-76557138 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76536303 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 164 (I164T)
Ref Sequence ENSEMBL: ENSMUSP00000046856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048678]
Predicted Effect probably damaging
Transcript: ENSMUST00000048678
AA Change: I164T

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000046856
Gene: ENSMUSG00000033105
AA Change: I164T

DomainStartEndE-ValueType
Pfam:SQHop_cyclase_N 80 373 2.4e-47 PFAM
Pfam:Prenyltrans 84 117 3.9e-3 PFAM
Pfam:Prenyltrans 123 166 5.2e-14 PFAM
Pfam:SQHop_cyclase_C 384 722 4.6e-58 PFAM
Pfam:Prenyltrans 560 601 9.9e-14 PFAM
Pfam:Prenyltrans 611 663 1.4e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159013
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159172
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160671
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162475
Meta Mutation Damage Score 0.364 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.3%
  • 20x: 86.1%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: This gene encodes an enzyme that catalyzes the conversion of (S)-2,3 oxidosqualene to lanosterol. The encoded protein is a member of the terpene cyclase/mutase family and catalyzes the first step in the biosynthesis of cholesterol, steroid hormones, and vitamin D. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,324,435 V214E probably damaging Het
Adh1 A G 3: 138,286,795 D224G probably damaging Het
Arhgap28 C A 17: 67,857,464 Q554H probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Brat1 G A 5: 140,718,013 V674I probably benign Het
Brd2 ATCTTCTTC ATCTTC 17: 34,114,007 probably benign Het
Ccdc162 T C 10: 41,553,182 D438G possibly damaging Het
Cyp4x1 T A 4: 115,112,791 probably benign Het
Dip2a T C 10: 76,279,820 probably benign Het
Eif2s1 A G 12: 78,881,168 D206G probably benign Het
Elovl7 T A 13: 108,282,494 I220N possibly damaging Het
Gsto1 A G 19: 47,857,942 E76G probably damaging Het
Hspa14 A T 2: 3,508,821 W12R probably damaging Het
L3mbtl2 T A 15: 81,676,317 C260S possibly damaging Het
Lama3 G T 18: 12,481,098 probably null Het
Lrrc34 T A 3: 30,643,579 probably benign Het
Lrrc45 A T 11: 120,720,013 Q525L probably benign Het
Myh11 T A 16: 14,205,931 K1527* probably null Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Ncoa1 T A 12: 4,270,737 probably benign Het
Olfr262 G T 19: 12,241,182 Q160K possibly damaging Het
Olfr768 A T 10: 129,093,690 C95S probably damaging Het
Pafah1b3 T C 7: 25,297,135 E41G possibly damaging Het
Pnmal1 C T 7: 16,960,984 P255S possibly damaging Het
Prkar2b A T 12: 31,962,988 probably benign Het
Rbck1 A T 2: 152,327,241 probably benign Het
Rcor2 A G 19: 7,271,030 S137G possibly damaging Het
Slc25a48 T A 13: 56,448,991 probably benign Het
Slc7a4 A G 16: 17,573,944 probably null Het
Tert T C 13: 73,642,353 probably benign Het
Traf7 A T 17: 24,511,681 I344N probably damaging Het
Vmn1r194 T A 13: 22,245,066 F284L probably damaging Het
Xpc A G 6: 91,493,238 M699T probably damaging Het
Zbtb5 T C 4: 44,993,968 H472R possibly damaging Het
Zfp786 A G 6: 47,825,079 V88A probably benign Het
Zkscan7 T C 9: 122,895,163 I399T probably benign Het
Zyg11b G A 4: 108,250,812 R466C probably damaging Het
Other mutations in Lss
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02164:Lss APN 10 76536260 missense probably damaging 1.00
IGL02561:Lss APN 10 76540430 unclassified probably benign
IGL02991:Lss APN 10 76543911 unclassified probably benign
IGL03059:Lss APN 10 76532026 splice site probably benign
IGL03328:Lss APN 10 76540951 missense probably damaging 1.00
IGL03389:Lss APN 10 76536339 missense probably damaging 1.00
R1529:Lss UTSW 10 76536289 nonsense probably null
R1727:Lss UTSW 10 76539844 missense possibly damaging 0.95
R1815:Lss UTSW 10 76552964 missense probably damaging 1.00
R1940:Lss UTSW 10 76545462 missense possibly damaging 0.95
R2051:Lss UTSW 10 76531878 missense possibly damaging 0.63
R2061:Lss UTSW 10 76546098 unclassified probably null
R3700:Lss UTSW 10 76546192 missense probably damaging 1.00
R4020:Lss UTSW 10 76547444 missense probably damaging 1.00
R4619:Lss UTSW 10 76536255 missense probably benign 0.11
R4995:Lss UTSW 10 76547537 missense probably benign 0.10
R5056:Lss UTSW 10 76552926 splice site probably null
R5134:Lss UTSW 10 76546236 unclassified probably benign
R6074:Lss UTSW 10 76543859 missense probably damaging 1.00
R6140:Lss UTSW 10 76550688 missense probably damaging 1.00
R7214:Lss UTSW 10 76547471 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGACTCAAGTGCCAAGTTAAAGCC -3'
(R):5'- TTTTCCCAGTGTTCCAATGAGAGGTG -3'

Sequencing Primer
(F):5'- ACATGACTAAACTTTCCCTGGGTG -3'
(R):5'- GCATCTTACTAATTCCCATTTACCAG -3'
Posted On2014-03-14