Incidental Mutation 'R1426:Prkar2b'
ID162255
Institutional Source Beutler Lab
Gene Symbol Prkar2b
Ensembl Gene ENSMUSG00000002997
Gene Nameprotein kinase, cAMP dependent regulatory, type II beta
SynonymsRII(beta), Pkarb2, PKARIIbeta
MMRRC Submission 039482-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.692) question?
Stock #R1426 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location31958476-32061296 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 31962988 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003079] [ENSMUST00000036497] [ENSMUST00000146865]
Predicted Effect probably benign
Transcript: ENSMUST00000003079
SMART Domains Protein: ENSMUSP00000003079
Gene: ENSMUSG00000002997

DomainStartEndE-ValueType
RIIa 7 44 7.78e-17 SMART
low complexity region 61 68 N/A INTRINSIC
low complexity region 86 101 N/A INTRINSIC
cNMP 152 272 7.2e-26 SMART
cNMP 274 398 8.53e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000036497
SMART Domains Protein: ENSMUSP00000039797
Gene: ENSMUSG00000002997

DomainStartEndE-ValueType
RIIa 7 44 7.78e-17 SMART
low complexity region 61 68 N/A INTRINSIC
low complexity region 86 101 N/A INTRINSIC
cNMP 152 272 7.2e-26 SMART
cNMP 274 398 8.53e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146865
SMART Domains Protein: ENSMUSP00000135290
Gene: ENSMUSG00000002997

DomainStartEndE-ValueType
cNMP 1 112 1.33e-15 SMART
cNMP 114 238 8.53e-28 SMART
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.3%
  • 20x: 86.1%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] cAMP is a signaling molecule important for a variety of cellular functions. cAMP exerts its effects by activating the cAMP-dependent protein kinase, which transduces the signal through phosphorylation of different target proteins. The inactive kinase holoenzyme is a tetramer composed of two regulatory and two catalytic subunits. cAMP causes the dissociation of the inactive holoenzyme into a dimer of regulatory subunits bound to four cAMP and two free monomeric catalytic subunits. Four different regulatory subunits and three catalytic subunits have been identified in humans. The protein encoded by this gene is one of the regulatory subunits. This subunit can be phosphorylated by the activated catalytic subunit. This subunit has been shown to interact with and suppress the transcriptional activity of the cAMP responsive element binding protein 1 (CREB1) in activated T cells. Knockout studies in mice suggest that this subunit may play an important role in regulating energy balance and adiposity. The studies also suggest that this subunit may mediate the gene induction and cataleptic behavior induced by haloperidol. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygou null mice are lean, weigh less than controls, and have reduced white fat pad size. Mice are resistant to both diet-induced obesity and to diet-induced insulin resistance. Mice show impaired coordination and increased sensitivity to chronic amphetamine exposure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,324,435 V214E probably damaging Het
Adh1 A G 3: 138,286,795 D224G probably damaging Het
Arhgap28 C A 17: 67,857,464 Q554H probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Brat1 G A 5: 140,718,013 V674I probably benign Het
Brd2 ATCTTCTTC ATCTTC 17: 34,114,007 probably benign Het
Ccdc162 T C 10: 41,553,182 D438G possibly damaging Het
Cyp4x1 T A 4: 115,112,791 probably benign Het
Dip2a T C 10: 76,279,820 probably benign Het
Eif2s1 A G 12: 78,881,168 D206G probably benign Het
Elovl7 T A 13: 108,282,494 I220N possibly damaging Het
Gsto1 A G 19: 47,857,942 E76G probably damaging Het
Hspa14 A T 2: 3,508,821 W12R probably damaging Het
L3mbtl2 T A 15: 81,676,317 C260S possibly damaging Het
Lama3 G T 18: 12,481,098 probably null Het
Lrrc34 T A 3: 30,643,579 probably benign Het
Lrrc45 A T 11: 120,720,013 Q525L probably benign Het
Lss T C 10: 76,536,303 I164T probably damaging Het
Myh11 T A 16: 14,205,931 K1527* probably null Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Ncoa1 T A 12: 4,270,737 probably benign Het
Olfr262 G T 19: 12,241,182 Q160K possibly damaging Het
Olfr768 A T 10: 129,093,690 C95S probably damaging Het
Pafah1b3 T C 7: 25,297,135 E41G possibly damaging Het
Pnmal1 C T 7: 16,960,984 P255S possibly damaging Het
Rbck1 A T 2: 152,327,241 probably benign Het
Rcor2 A G 19: 7,271,030 S137G possibly damaging Het
Slc25a48 T A 13: 56,448,991 probably benign Het
Slc7a4 A G 16: 17,573,944 probably null Het
Tert T C 13: 73,642,353 probably benign Het
Traf7 A T 17: 24,511,681 I344N probably damaging Het
Vmn1r194 T A 13: 22,245,066 F284L probably damaging Het
Xpc A G 6: 91,493,238 M699T probably damaging Het
Zbtb5 T C 4: 44,993,968 H472R possibly damaging Het
Zfp786 A G 6: 47,825,079 V88A probably benign Het
Zkscan7 T C 9: 122,895,163 I399T probably benign Het
Zyg11b G A 4: 108,250,812 R466C probably damaging Het
Other mutations in Prkar2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01549:Prkar2b APN 12 32061072 missense possibly damaging 0.55
IGL02056:Prkar2b APN 12 31975910 splice site probably benign
IGL02071:Prkar2b APN 12 31963017 missense probably damaging 1.00
IGL02118:Prkar2b APN 12 31975964 missense probably damaging 1.00
spark UTSW 12 31987974 splice site probably null
R0211:Prkar2b UTSW 12 31972184 missense probably benign 0.30
R0362:Prkar2b UTSW 12 31987974 splice site probably null
R0485:Prkar2b UTSW 12 31976035 splice site probably benign
R0898:Prkar2b UTSW 12 31963002 missense possibly damaging 0.90
R1997:Prkar2b UTSW 12 31963935 missense probably damaging 0.99
R2114:Prkar2b UTSW 12 31967280 missense probably damaging 1.00
R2346:Prkar2b UTSW 12 31972150 missense probably benign 0.01
R2513:Prkar2b UTSW 12 31975929 missense possibly damaging 0.93
R3875:Prkar2b UTSW 12 31965123 missense probably benign 0.01
R5301:Prkar2b UTSW 12 31975928 missense probably damaging 1.00
R5316:Prkar2b UTSW 12 32060985 missense probably damaging 0.97
R5351:Prkar2b UTSW 12 31972127 missense probably damaging 1.00
R6025:Prkar2b UTSW 12 32060856 missense possibly damaging 0.68
R6028:Prkar2b UTSW 12 31993758 missense possibly damaging 0.50
R6563:Prkar2b UTSW 12 31993786 splice site probably null
R7074:Prkar2b UTSW 12 31972148 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTAGCAGAAAGCACAGGCAGATGG -3'
(R):5'- TTAGGGTAAATCAGAAGTTGAAGAGAACGGAG -3'

Sequencing Primer
(F):5'- CACAGAACGTGCCGTTTTAG -3'
(R):5'- AGCTGTGGAAATCGCTCG -3'
Posted On2014-03-14