Incidental Mutation 'R1426:Prkar2b'
ID 162255
Institutional Source Beutler Lab
Gene Symbol Prkar2b
Ensembl Gene ENSMUSG00000002997
Gene Name protein kinase, cAMP dependent regulatory, type II beta
Synonyms RII(beta), Pkarb2, PKARIIbeta
MMRRC Submission 039482-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.329) question?
Stock # R1426 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 32008475-32111295 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 32012987 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003079] [ENSMUST00000036497] [ENSMUST00000146865]
AlphaFold P31324
Predicted Effect probably benign
Transcript: ENSMUST00000003079
SMART Domains Protein: ENSMUSP00000003079
Gene: ENSMUSG00000002997

DomainStartEndE-ValueType
RIIa 7 44 7.78e-17 SMART
low complexity region 61 68 N/A INTRINSIC
low complexity region 86 101 N/A INTRINSIC
cNMP 152 272 7.2e-26 SMART
cNMP 274 398 8.53e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000036497
SMART Domains Protein: ENSMUSP00000039797
Gene: ENSMUSG00000002997

DomainStartEndE-ValueType
RIIa 7 44 7.78e-17 SMART
low complexity region 61 68 N/A INTRINSIC
low complexity region 86 101 N/A INTRINSIC
cNMP 152 272 7.2e-26 SMART
cNMP 274 398 8.53e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146865
SMART Domains Protein: ENSMUSP00000135290
Gene: ENSMUSG00000002997

DomainStartEndE-ValueType
cNMP 1 112 1.33e-15 SMART
cNMP 114 238 8.53e-28 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.3%
  • 20x: 86.1%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] cAMP is a signaling molecule important for a variety of cellular functions. cAMP exerts its effects by activating the cAMP-dependent protein kinase, which transduces the signal through phosphorylation of different target proteins. The inactive kinase holoenzyme is a tetramer composed of two regulatory and two catalytic subunits. cAMP causes the dissociation of the inactive holoenzyme into a dimer of regulatory subunits bound to four cAMP and two free monomeric catalytic subunits. Four different regulatory subunits and three catalytic subunits have been identified in humans. The protein encoded by this gene is one of the regulatory subunits. This subunit can be phosphorylated by the activated catalytic subunit. This subunit has been shown to interact with and suppress the transcriptional activity of the cAMP responsive element binding protein 1 (CREB1) in activated T cells. Knockout studies in mice suggest that this subunit may play an important role in regulating energy balance and adiposity. The studies also suggest that this subunit may mediate the gene induction and cataleptic behavior induced by haloperidol. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygou null mice are lean, weigh less than controls, and have reduced white fat pad size. Mice are resistant to both diet-induced obesity and to diet-induced insulin resistance. Mice show impaired coordination and increased sensitivity to chronic amphetamine exposure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,635,361 (GRCm39) V214E probably damaging Het
Adh1 A G 3: 137,992,556 (GRCm39) D224G probably damaging Het
Arhgap28 C A 17: 68,164,459 (GRCm39) Q554H probably damaging Het
Atp8a2 T C 14: 60,097,719 (GRCm39) K770E probably benign Het
Brat1 G A 5: 140,703,768 (GRCm39) V674I probably benign Het
Brd2 ATCTTCTTC ATCTTC 17: 34,332,981 (GRCm39) probably benign Het
Ccdc162 T C 10: 41,429,178 (GRCm39) D438G possibly damaging Het
Cyp4x1 T A 4: 114,969,988 (GRCm39) probably benign Het
Dip2a T C 10: 76,115,654 (GRCm39) probably benign Het
Eif2s1 A G 12: 78,927,942 (GRCm39) D206G probably benign Het
Elovl7 T A 13: 108,419,028 (GRCm39) I220N possibly damaging Het
Gsto1 A G 19: 47,846,381 (GRCm39) E76G probably damaging Het
Hspa14 A T 2: 3,509,858 (GRCm39) W12R probably damaging Het
L3mbtl2 T A 15: 81,560,518 (GRCm39) C260S possibly damaging Het
Lama3 G T 18: 12,614,155 (GRCm39) probably null Het
Lrrc34 T A 3: 30,697,728 (GRCm39) probably benign Het
Lrrc45 A T 11: 120,610,839 (GRCm39) Q525L probably benign Het
Lss T C 10: 76,372,137 (GRCm39) I164T probably damaging Het
Myh11 T A 16: 14,023,795 (GRCm39) K1527* probably null Het
Naip2 T C 13: 100,298,362 (GRCm39) E558G probably benign Het
Naip2 C T 13: 100,298,368 (GRCm39) G556D probably benign Het
Ncoa1 T A 12: 4,320,737 (GRCm39) probably benign Het
Or5an1c G T 19: 12,218,546 (GRCm39) Q160K possibly damaging Het
Or6c38 A T 10: 128,929,559 (GRCm39) C95S probably damaging Het
Pafah1b3 T C 7: 24,996,560 (GRCm39) E41G possibly damaging Het
Pnma8a C T 7: 16,694,909 (GRCm39) P255S possibly damaging Het
Rbck1 A T 2: 152,169,161 (GRCm39) probably benign Het
Rcor2 A G 19: 7,248,395 (GRCm39) S137G possibly damaging Het
Slc25a48 T A 13: 56,596,804 (GRCm39) probably benign Het
Slc7a4 A G 16: 17,391,808 (GRCm39) probably null Het
Tert T C 13: 73,790,472 (GRCm39) probably benign Het
Traf7 A T 17: 24,730,655 (GRCm39) I344N probably damaging Het
Vmn1r194 T A 13: 22,429,236 (GRCm39) F284L probably damaging Het
Xpc A G 6: 91,470,220 (GRCm39) M699T probably damaging Het
Zbtb5 T C 4: 44,993,968 (GRCm39) H472R possibly damaging Het
Zfp786 A G 6: 47,802,013 (GRCm39) V88A probably benign Het
Zkscan7 T C 9: 122,724,228 (GRCm39) I399T probably benign Het
Zyg11b G A 4: 108,108,009 (GRCm39) R466C probably damaging Het
Other mutations in Prkar2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01549:Prkar2b APN 12 32,111,071 (GRCm39) missense possibly damaging 0.55
IGL02056:Prkar2b APN 12 32,025,909 (GRCm39) splice site probably benign
IGL02071:Prkar2b APN 12 32,013,016 (GRCm39) missense probably damaging 1.00
IGL02118:Prkar2b APN 12 32,025,963 (GRCm39) missense probably damaging 1.00
spark UTSW 12 32,037,973 (GRCm39) splice site probably null
R0211:Prkar2b UTSW 12 32,022,183 (GRCm39) missense probably benign 0.30
R0362:Prkar2b UTSW 12 32,037,973 (GRCm39) splice site probably null
R0485:Prkar2b UTSW 12 32,026,034 (GRCm39) splice site probably benign
R0898:Prkar2b UTSW 12 32,013,001 (GRCm39) missense possibly damaging 0.90
R1997:Prkar2b UTSW 12 32,013,934 (GRCm39) missense probably damaging 0.99
R2114:Prkar2b UTSW 12 32,017,279 (GRCm39) missense probably damaging 1.00
R2346:Prkar2b UTSW 12 32,022,149 (GRCm39) missense probably benign 0.01
R2513:Prkar2b UTSW 12 32,025,928 (GRCm39) missense possibly damaging 0.93
R3875:Prkar2b UTSW 12 32,015,122 (GRCm39) missense probably benign 0.01
R5301:Prkar2b UTSW 12 32,025,927 (GRCm39) missense probably damaging 1.00
R5316:Prkar2b UTSW 12 32,110,984 (GRCm39) missense probably damaging 0.97
R5351:Prkar2b UTSW 12 32,022,126 (GRCm39) missense probably damaging 1.00
R6025:Prkar2b UTSW 12 32,110,855 (GRCm39) missense possibly damaging 0.68
R6028:Prkar2b UTSW 12 32,043,757 (GRCm39) missense possibly damaging 0.50
R6563:Prkar2b UTSW 12 32,043,785 (GRCm39) splice site probably null
R7074:Prkar2b UTSW 12 32,022,147 (GRCm39) missense probably damaging 1.00
R7431:Prkar2b UTSW 12 32,013,150 (GRCm39) splice site probably null
R7747:Prkar2b UTSW 12 32,110,937 (GRCm39) missense probably benign 0.23
R7978:Prkar2b UTSW 12 32,013,024 (GRCm39) missense possibly damaging 0.81
R8926:Prkar2b UTSW 12 32,111,080 (GRCm39) start codon destroyed probably null 0.99
R9102:Prkar2b UTSW 12 32,013,025 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTAGCAGAAAGCACAGGCAGATGG -3'
(R):5'- TTAGGGTAAATCAGAAGTTGAAGAGAACGGAG -3'

Sequencing Primer
(F):5'- CACAGAACGTGCCGTTTTAG -3'
(R):5'- AGCTGTGGAAATCGCTCG -3'
Posted On 2014-03-14