Incidental Mutation 'R1426:Slc7a4'
ID162263
Institutional Source Beutler Lab
Gene Symbol Slc7a4
Ensembl Gene ENSMUSG00000022756
Gene Namesolute carrier family 7 (cationic amino acid transporter, y+ system), member 4
Synonyms
MMRRC Submission 039482-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.434) question?
Stock #R1426 (G1)
Quality Score192
Status Validated
Chromosome16
Chromosomal Location17572018-17583214 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 17573944 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023441] [ENSMUST00000063544] [ENSMUST00000090165] [ENSMUST00000171002] [ENSMUST00000172164] [ENSMUST00000231283] [ENSMUST00000231552] [ENSMUST00000231615] [ENSMUST00000231645] [ENSMUST00000231806] [ENSMUST00000232186] [ENSMUST00000232226] [ENSMUST00000232336] [ENSMUST00000232385]
Predicted Effect probably null
Transcript: ENSMUST00000023441
SMART Domains Protein: ENSMUSP00000023441
Gene: ENSMUSG00000022758

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
Pfam:P2X_receptor 25 385 7.9e-139 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000063544
SMART Domains Protein: ENSMUSP00000067243
Gene: ENSMUSG00000022756

DomainStartEndE-ValueType
Pfam:AA_permease_2 37 436 1.4e-49 PFAM
Pfam:AA_permease 41 426 9.4e-38 PFAM
transmembrane domain 476 498 N/A INTRINSIC
transmembrane domain 508 530 N/A INTRINSIC
Pfam:AA_permease_C 540 590 1.4e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000090165
SMART Domains Protein: ENSMUSP00000087627
Gene: ENSMUSG00000022756

DomainStartEndE-ValueType
Pfam:AA_permease_2 37 368 1.2e-42 PFAM
Pfam:AA_permease 41 370 2.7e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116648
Predicted Effect probably null
Transcript: ENSMUST00000171002
SMART Domains Protein: ENSMUSP00000132727
Gene: ENSMUSG00000022758

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
Pfam:P2X_receptor 25 197 1e-65 PFAM
Pfam:P2X_receptor 185 362 7e-63 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000172164
SMART Domains Protein: ENSMUSP00000127280
Gene: ENSMUSG00000022756

DomainStartEndE-ValueType
Pfam:AA_permease_2 37 498 2.6e-46 PFAM
Pfam:AA_permease 41 423 4.5e-36 PFAM
transmembrane domain 508 530 N/A INTRINSIC
Pfam:AA_permease_C 540 590 1.5e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231283
Predicted Effect probably benign
Transcript: ENSMUST00000231552
Predicted Effect probably null
Transcript: ENSMUST00000231615
Predicted Effect probably benign
Transcript: ENSMUST00000231645
Predicted Effect probably benign
Transcript: ENSMUST00000231806
Predicted Effect probably benign
Transcript: ENSMUST00000232186
Predicted Effect probably null
Transcript: ENSMUST00000232226
Predicted Effect probably benign
Transcript: ENSMUST00000232336
Predicted Effect probably null
Transcript: ENSMUST00000232385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232429
Meta Mutation Damage Score 0.58 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.3%
  • 20x: 86.1%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,324,435 V214E probably damaging Het
Adh1 A G 3: 138,286,795 D224G probably damaging Het
Arhgap28 C A 17: 67,857,464 Q554H probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Brat1 G A 5: 140,718,013 V674I probably benign Het
Brd2 ATCTTCTTC ATCTTC 17: 34,114,007 probably benign Het
Ccdc162 T C 10: 41,553,182 D438G possibly damaging Het
Cyp4x1 T A 4: 115,112,791 probably benign Het
Dip2a T C 10: 76,279,820 probably benign Het
Eif2s1 A G 12: 78,881,168 D206G probably benign Het
Elovl7 T A 13: 108,282,494 I220N possibly damaging Het
Gsto1 A G 19: 47,857,942 E76G probably damaging Het
Hspa14 A T 2: 3,508,821 W12R probably damaging Het
L3mbtl2 T A 15: 81,676,317 C260S possibly damaging Het
Lama3 G T 18: 12,481,098 probably null Het
Lrrc34 T A 3: 30,643,579 probably benign Het
Lrrc45 A T 11: 120,720,013 Q525L probably benign Het
Lss T C 10: 76,536,303 I164T probably damaging Het
Myh11 T A 16: 14,205,931 K1527* probably null Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Ncoa1 T A 12: 4,270,737 probably benign Het
Olfr262 G T 19: 12,241,182 Q160K possibly damaging Het
Olfr768 A T 10: 129,093,690 C95S probably damaging Het
Pafah1b3 T C 7: 25,297,135 E41G possibly damaging Het
Pnmal1 C T 7: 16,960,984 P255S possibly damaging Het
Prkar2b A T 12: 31,962,988 probably benign Het
Rbck1 A T 2: 152,327,241 probably benign Het
Rcor2 A G 19: 7,271,030 S137G possibly damaging Het
Slc25a48 T A 13: 56,448,991 probably benign Het
Tert T C 13: 73,642,353 probably benign Het
Traf7 A T 17: 24,511,681 I344N probably damaging Het
Vmn1r194 T A 13: 22,245,066 F284L probably damaging Het
Xpc A G 6: 91,493,238 M699T probably damaging Het
Zbtb5 T C 4: 44,993,968 H472R possibly damaging Het
Zfp786 A G 6: 47,825,079 V88A probably benign Het
Zkscan7 T C 9: 122,895,163 I399T probably benign Het
Zyg11b G A 4: 108,250,812 R466C probably damaging Het
Other mutations in Slc7a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02717:Slc7a4 APN 16 17574575 missense possibly damaging 0.90
R0066:Slc7a4 UTSW 16 17574011 missense probably benign 0.02
R0066:Slc7a4 UTSW 16 17574011 missense probably benign 0.02
R0402:Slc7a4 UTSW 16 17575633 missense probably damaging 1.00
R1926:Slc7a4 UTSW 16 17575704 missense probably damaging 1.00
R2097:Slc7a4 UTSW 16 17573455 splice site probably null
R2140:Slc7a4 UTSW 16 17574544 missense possibly damaging 0.91
R4496:Slc7a4 UTSW 16 17575812 missense probably damaging 1.00
R4548:Slc7a4 UTSW 16 17575345 missense probably benign 0.01
R4570:Slc7a4 UTSW 16 17574277 missense probably benign 0.00
R4631:Slc7a4 UTSW 16 17574391 missense probably damaging 1.00
R4658:Slc7a4 UTSW 16 17575933 missense probably damaging 1.00
R4825:Slc7a4 UTSW 16 17574521 missense probably damaging 1.00
R5102:Slc7a4 UTSW 16 17575618 missense probably damaging 1.00
R5364:Slc7a4 UTSW 16 17573363 missense probably benign 0.33
R5650:Slc7a4 UTSW 16 17575684 missense possibly damaging 0.94
R5666:Slc7a4 UTSW 16 17575951 utr 5 prime probably benign
R5944:Slc7a4 UTSW 16 17574356 missense possibly damaging 0.95
R6769:Slc7a4 UTSW 16 17575320 missense possibly damaging 0.72
R7381:Slc7a4 UTSW 16 17575056 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGAGAGTTGGAGCCATGTGTACC -3'
(R):5'- TGAGCAGACCTCAATGTCTGAGCC -3'

Sequencing Primer
(F):5'- GAGCCATGTGTACCCACACC -3'
(R):5'- ATGGATGCAGCCCTGGAAC -3'
Posted On2014-03-14