Incidental Mutation 'R1426:Traf7'
ID162264
Institutional Source Beutler Lab
Gene Symbol Traf7
Ensembl Gene ENSMUSG00000052752
Gene NameTNF receptor-associated factor 7
SynonymsRFWD1
MMRRC Submission 039482-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.539) question?
Stock #R1426 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location24508562-24527938 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24511681 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 344 (I344N)
Ref Sequence ENSEMBL: ENSMUSP00000135267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024958] [ENSMUST00000070777] [ENSMUST00000088464] [ENSMUST00000176086] [ENSMUST00000176178] [ENSMUST00000176237] [ENSMUST00000176324] [ENSMUST00000176353] [ENSMUST00000176652] [ENSMUST00000176668] [ENSMUST00000177025] [ENSMUST00000177154] [ENSMUST00000177193] [ENSMUST00000177401] [ENSMUST00000177405]
Predicted Effect probably benign
Transcript: ENSMUST00000024958
SMART Domains Protein: ENSMUSP00000024958
Gene: ENSMUSG00000033597

DomainStartEndE-ValueType
ANK 48 77 9.93e-5 SMART
ANK 81 110 1.9e-1 SMART
ANK 114 143 1.51e-4 SMART
ANK 147 176 1.15e0 SMART
ANK 188 217 2.6e-8 SMART
ANK 220 249 3.31e-1 SMART
SH3 284 346 3.62e-5 SMART
Pfam:Caskin1-CID 373 421 3e-26 PFAM
SAM 473 539 3.63e-15 SMART
SAM 542 609 5.41e-14 SMART
low complexity region 631 647 N/A INTRINSIC
low complexity region 667 679 N/A INTRINSIC
low complexity region 715 724 N/A INTRINSIC
low complexity region 841 863 N/A INTRINSIC
Pfam:Caskin-Pro-rich 878 966 3e-37 PFAM
low complexity region 1163 1168 N/A INTRINSIC
low complexity region 1190 1216 N/A INTRINSIC
low complexity region 1222 1232 N/A INTRINSIC
low complexity region 1269 1288 N/A INTRINSIC
low complexity region 1294 1312 N/A INTRINSIC
low complexity region 1315 1333 N/A INTRINSIC
low complexity region 1344 1359 N/A INTRINSIC
Pfam:Caskin-tail 1369 1431 7.2e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000070777
AA Change: I344N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000069334
Gene: ENSMUSG00000052752
AA Change: I344N

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
RING 92 125 4.73e-6 SMART
coiled coil region 264 332 N/A INTRINSIC
WD40 344 383 8.35e-11 SMART
WD40 387 424 8.42e-7 SMART
WD40 427 463 2.09e-2 SMART
WD40 468 504 1.92e0 SMART
WD40 507 544 5.15e-2 SMART
WD40 547 588 1.78e-5 SMART
WD40 591 628 1.63e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000088464
AA Change: I384N

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000085812
Gene: ENSMUSG00000052752
AA Change: I384N

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 90 104 N/A INTRINSIC
low complexity region 109 117 N/A INTRINSIC
RING 130 163 4.73e-6 SMART
Pfam:zf-TRAF 221 277 3.4e-8 PFAM
coiled coil region 304 372 N/A INTRINSIC
WD40 384 423 8.35e-11 SMART
WD40 427 464 8.42e-7 SMART
WD40 467 503 2.09e-2 SMART
WD40 508 544 1.92e0 SMART
WD40 547 584 5.15e-2 SMART
WD40 587 628 1.78e-5 SMART
WD40 631 668 1.63e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175698
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175732
Predicted Effect probably benign
Transcript: ENSMUST00000176086
SMART Domains Protein: ENSMUSP00000135845
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 103 132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176178
SMART Domains Protein: ENSMUSP00000134808
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176237
SMART Domains Protein: ENSMUSP00000134946
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
RING 91 124 4.73e-6 SMART
Pfam:zf-TRAF 182 238 8.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176324
Predicted Effect probably damaging
Transcript: ENSMUST00000176353
AA Change: I344N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000135267
Gene: ENSMUSG00000052752
AA Change: I344N

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
RING 92 125 4.73e-6 SMART
coiled coil region 264 332 N/A INTRINSIC
WD40 344 383 8.35e-11 SMART
WD40 387 424 8.42e-7 SMART
WD40 427 463 2.09e-2 SMART
WD40 468 504 1.92e0 SMART
WD40 507 544 5.15e-2 SMART
WD40 547 588 1.78e-5 SMART
WD40 591 628 1.63e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176530
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176633
Predicted Effect possibly damaging
Transcript: ENSMUST00000176652
AA Change: I384N

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134759
Gene: ENSMUSG00000052752
AA Change: I384N

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 90 104 N/A INTRINSIC
low complexity region 109 117 N/A INTRINSIC
RING 130 163 4.73e-6 SMART
coiled coil region 304 372 N/A INTRINSIC
WD40 384 423 8.35e-11 SMART
WD40 427 464 8.42e-7 SMART
WD40 467 503 2.09e-2 SMART
WD40 508 544 1.92e0 SMART
WD40 547 584 5.15e-2 SMART
WD40 587 628 1.78e-5 SMART
WD40 631 668 1.63e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176668
SMART Domains Protein: ENSMUSP00000135586
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176805
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177024
Predicted Effect probably benign
Transcript: ENSMUST00000177025
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177139
Predicted Effect probably benign
Transcript: ENSMUST00000177154
SMART Domains Protein: ENSMUSP00000135874
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 91 105 N/A INTRINSIC
low complexity region 110 118 N/A INTRINSIC
RING 131 164 4.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177193
SMART Domains Protein: ENSMUSP00000135288
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 90 104 N/A INTRINSIC
low complexity region 109 117 N/A INTRINSIC
RING 130 163 4.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177401
Predicted Effect probably benign
Transcript: ENSMUST00000177405
SMART Domains Protein: ENSMUSP00000135127
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177502
SMART Domains Protein: ENSMUSP00000134970
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
RING 24 68 4.24e-2 SMART
Meta Mutation Damage Score 0.354 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.3%
  • 20x: 86.1%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Tumor necrosis factor (TNF; see MIM 191160) receptor-associated factors, such as TRAF7, are signal transducers for members of the TNF receptor superfamily (see MIM 191190). TRAFs are composed of an N-terminal cysteine/histidine-rich region containing zinc RING and/or zinc finger motifs; a coiled-coil (leucine zipper) motif; and a homologous region that defines the TRAF family, the TRAF domain, which is involved in self-association and receptor binding.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,324,435 V214E probably damaging Het
Adh1 A G 3: 138,286,795 D224G probably damaging Het
Arhgap28 C A 17: 67,857,464 Q554H probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Brat1 G A 5: 140,718,013 V674I probably benign Het
Brd2 ATCTTCTTC ATCTTC 17: 34,114,007 probably benign Het
Ccdc162 T C 10: 41,553,182 D438G possibly damaging Het
Cyp4x1 T A 4: 115,112,791 probably benign Het
Dip2a T C 10: 76,279,820 probably benign Het
Eif2s1 A G 12: 78,881,168 D206G probably benign Het
Elovl7 T A 13: 108,282,494 I220N possibly damaging Het
Gsto1 A G 19: 47,857,942 E76G probably damaging Het
Hspa14 A T 2: 3,508,821 W12R probably damaging Het
L3mbtl2 T A 15: 81,676,317 C260S possibly damaging Het
Lama3 G T 18: 12,481,098 probably null Het
Lrrc34 T A 3: 30,643,579 probably benign Het
Lrrc45 A T 11: 120,720,013 Q525L probably benign Het
Lss T C 10: 76,536,303 I164T probably damaging Het
Myh11 T A 16: 14,205,931 K1527* probably null Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Ncoa1 T A 12: 4,270,737 probably benign Het
Olfr262 G T 19: 12,241,182 Q160K possibly damaging Het
Olfr768 A T 10: 129,093,690 C95S probably damaging Het
Pafah1b3 T C 7: 25,297,135 E41G possibly damaging Het
Pnmal1 C T 7: 16,960,984 P255S possibly damaging Het
Prkar2b A T 12: 31,962,988 probably benign Het
Rbck1 A T 2: 152,327,241 probably benign Het
Rcor2 A G 19: 7,271,030 S137G possibly damaging Het
Slc25a48 T A 13: 56,448,991 probably benign Het
Slc7a4 A G 16: 17,573,944 probably null Het
Tert T C 13: 73,642,353 probably benign Het
Vmn1r194 T A 13: 22,245,066 F284L probably damaging Het
Xpc A G 6: 91,493,238 M699T probably damaging Het
Zbtb5 T C 4: 44,993,968 H472R possibly damaging Het
Zfp786 A G 6: 47,825,079 V88A probably benign Het
Zkscan7 T C 9: 122,895,163 I399T probably benign Het
Zyg11b G A 4: 108,250,812 R466C probably damaging Het
Other mutations in Traf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01674:Traf7 APN 17 24510375 unclassified probably benign
IGL01821:Traf7 APN 17 24510499 missense probably damaging 0.99
IGL02263:Traf7 APN 17 24513046 missense possibly damaging 0.47
IGL02307:Traf7 APN 17 24513046 missense possibly damaging 0.47
IGL02321:Traf7 APN 17 24513046 missense possibly damaging 0.47
IGL02323:Traf7 APN 17 24513046 missense possibly damaging 0.47
IGL02636:Traf7 APN 17 24512990 missense probably benign
R0109:Traf7 UTSW 17 24513926 missense probably benign 0.12
R0109:Traf7 UTSW 17 24513926 missense probably benign 0.12
R0193:Traf7 UTSW 17 24510551 missense probably benign 0.22
R1484:Traf7 UTSW 17 24511811 missense possibly damaging 0.86
R1574:Traf7 UTSW 17 24510553 missense probably damaging 1.00
R1574:Traf7 UTSW 17 24510553 missense probably damaging 1.00
R1728:Traf7 UTSW 17 24512379 missense probably damaging 0.98
R1729:Traf7 UTSW 17 24512379 missense probably damaging 0.98
R1784:Traf7 UTSW 17 24512379 missense probably damaging 0.98
R1959:Traf7 UTSW 17 24513281 missense probably damaging 1.00
R1994:Traf7 UTSW 17 24510502 missense probably damaging 0.99
R2484:Traf7 UTSW 17 24511639 missense probably damaging 1.00
R4682:Traf7 UTSW 17 24513374 missense probably damaging 1.00
R4778:Traf7 UTSW 17 24510438 unclassified probably benign
R4779:Traf7 UTSW 17 24510438 unclassified probably benign
R4781:Traf7 UTSW 17 24510438 unclassified probably benign
R5120:Traf7 UTSW 17 24518744 nonsense probably null
R6594:Traf7 UTSW 17 24509839 missense possibly damaging 0.92
R6885:Traf7 UTSW 17 24512292 missense probably benign 0.28
R7396:Traf7 UTSW 17 24509545 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGTACAAGTGTCCCATACCTGC -3'
(R):5'- GCTTCATTACAGATCAGTGAGCCCC -3'

Sequencing Primer
(F):5'- CCAAGGCTGGTATGCAGTG -3'
(R):5'- CAGTGAGCCCCACCCAC -3'
Posted On2014-03-14