Incidental Mutation 'R1426:Brd2'
ID162265
Institutional Source Beutler Lab
Gene Symbol Brd2
Ensembl Gene ENSMUSG00000024335
Gene Namebromodomain containing 2
SynonymsFrg-1, Fsrg1, D17H6S113E, Ring3, Rnf3
MMRRC Submission 039482-MU
Accession Numbers

Genbank: NM_010238, NM_001025387; MGI: 99495

 

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1426 (G1)
Quality Score217
Status Validated
Chromosome17
Chromosomal Location34112023-34122634 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) ATCTTCTTC to ATCTTC at 34114007 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000025193] [ENSMUST00000095347] [ENSMUST00000114242] [ENSMUST00000151986] [ENSMUST00000154232]
Predicted Effect probably benign
Transcript: ENSMUST00000025193
SMART Domains Protein: ENSMUSP00000025193
Gene: ENSMUSG00000024335

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
BROMO 71 181 2.13e-43 SMART
low complexity region 256 276 N/A INTRINSIC
low complexity region 284 290 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
BROMO 345 454 1.13e-47 SMART
coiled coil region 486 537 N/A INTRINSIC
low complexity region 542 560 N/A INTRINSIC
low complexity region 583 593 N/A INTRINSIC
PDB:2JNS|A 635 712 3e-37 PDB
coiled coil region 721 750 N/A INTRINSIC
low complexity region 772 797 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095347
SMART Domains Protein: ENSMUSP00000092990
Gene: ENSMUSG00000024335

DomainStartEndE-ValueType
BROMO 25 135 1.3e-45 SMART
low complexity region 210 230 N/A INTRINSIC
low complexity region 238 244 N/A INTRINSIC
low complexity region 248 258 N/A INTRINSIC
BROMO 299 408 6.8e-50 SMART
coiled coil region 440 491 N/A INTRINSIC
low complexity region 496 514 N/A INTRINSIC
low complexity region 537 547 N/A INTRINSIC
PDB:2JNS|A 589 666 2e-37 PDB
coiled coil region 675 704 N/A INTRINSIC
low complexity region 726 751 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114242
SMART Domains Protein: ENSMUSP00000109880
Gene: ENSMUSG00000024335

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
BROMO 71 181 2.13e-43 SMART
low complexity region 256 276 N/A INTRINSIC
low complexity region 284 290 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
BROMO 345 454 1.13e-47 SMART
coiled coil region 486 537 N/A INTRINSIC
low complexity region 542 560 N/A INTRINSIC
low complexity region 583 593 N/A INTRINSIC
Pfam:BET 639 703 7.4e-35 PFAM
coiled coil region 721 750 N/A INTRINSIC
low complexity region 772 797 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142570
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148143
Predicted Effect probably benign
Transcript: ENSMUST00000151986
SMART Domains Protein: ENSMUSP00000117359
Gene: ENSMUSG00000024335

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
BROMO 71 181 2.13e-43 SMART
low complexity region 256 276 N/A INTRINSIC
low complexity region 284 290 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
BROMO 345 454 1.13e-47 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154232
SMART Domains Protein: ENSMUSP00000128835
Gene: ENSMUSG00000024335

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
low complexity region 50 71 N/A INTRINSIC
Blast:BROMO 72 110 4e-21 BLAST
PDB:3AQA|C 72 110 2e-22 PDB
SCOP:d1f68a_ 76 103 1e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155286
Predicted Effect probably benign
Transcript: ENSMUST00000173032
SMART Domains Protein: ENSMUSP00000134608
Gene: ENSMUSG00000024335

DomainStartEndE-ValueType
Pfam:Bromodomain 1 43 1.4e-6 PFAM
coiled coil region 73 124 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173204
Meta Mutation Damage Score 0.0808 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.3%
  • 20x: 86.1%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional regulator that belongs to the BET (bromodomains and extra terminal domain) family of proteins. This protein associates with transcription complexes and with acetylated chromatin during mitosis, and it selectively binds to the acetylated lysine-12 residue of histone H4 via its two bromodomains. The gene maps to the major histocompatability complex (MHC) class II region on chromosome 6p21.3, but sequence comparison suggests that the protein is not involved in the immune response. This gene has been implicated in juvenile myoclonic epilepsy, a common form of epilepsy that becomes apparent in adolescence. Multiple alternatively spliced variants have been described for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis with decreased embryo size, decreased cell proliferation, a delay in the cell cycle, and increased cell death. Heterozygous mice also display decreased cell proliferation. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted, other(2) Gene trapped(14)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,324,435 V214E probably damaging Het
Adh1 A G 3: 138,286,795 D224G probably damaging Het
Arhgap28 C A 17: 67,857,464 Q554H probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Brat1 G A 5: 140,718,013 V674I probably benign Het
Ccdc162 T C 10: 41,553,182 D438G possibly damaging Het
Cyp4x1 T A 4: 115,112,791 probably benign Het
Dip2a T C 10: 76,279,820 probably benign Het
Eif2s1 A G 12: 78,881,168 D206G probably benign Het
Elovl7 T A 13: 108,282,494 I220N possibly damaging Het
Gsto1 A G 19: 47,857,942 E76G probably damaging Het
Hspa14 A T 2: 3,508,821 W12R probably damaging Het
L3mbtl2 T A 15: 81,676,317 C260S possibly damaging Het
Lama3 G T 18: 12,481,098 probably null Het
Lrrc34 T A 3: 30,643,579 probably benign Het
Lrrc45 A T 11: 120,720,013 Q525L probably benign Het
Lss T C 10: 76,536,303 I164T probably damaging Het
Myh11 T A 16: 14,205,931 K1527* probably null Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Ncoa1 T A 12: 4,270,737 probably benign Het
Olfr262 G T 19: 12,241,182 Q160K possibly damaging Het
Olfr768 A T 10: 129,093,690 C95S probably damaging Het
Pafah1b3 T C 7: 25,297,135 E41G possibly damaging Het
Pnmal1 C T 7: 16,960,984 P255S possibly damaging Het
Prkar2b A T 12: 31,962,988 probably benign Het
Rbck1 A T 2: 152,327,241 probably benign Het
Rcor2 A G 19: 7,271,030 S137G possibly damaging Het
Slc25a48 T A 13: 56,448,991 probably benign Het
Slc7a4 A G 16: 17,573,944 probably null Het
Tert T C 13: 73,642,353 probably benign Het
Traf7 A T 17: 24,511,681 I344N probably damaging Het
Vmn1r194 T A 13: 22,245,066 F284L probably damaging Het
Xpc A G 6: 91,493,238 M699T probably damaging Het
Zbtb5 T C 4: 44,993,968 H472R possibly damaging Het
Zfp786 A G 6: 47,825,079 V88A probably benign Het
Zkscan7 T C 9: 122,895,163 I399T probably benign Het
Zyg11b G A 4: 108,250,812 R466C probably damaging Het
Other mutations in Brd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Brd2 APN 17 34114423 missense probably damaging 1.00
IGL01589:Brd2 APN 17 34117042 missense probably damaging 1.00
IGL01724:Brd2 APN 17 34117002 missense probably damaging 1.00
IGL01724:Brd2 APN 17 34117001 missense probably damaging 1.00
IGL02043:Brd2 APN 17 34112616 unclassified probably benign
crater UTSW 17 34113259 missense probably damaging 0.96
FR4449:Brd2 UTSW 17 34116336 unclassified probably benign
FR4548:Brd2 UTSW 17 34116336 unclassified probably benign
R0085:Brd2 UTSW 17 34113259 missense probably damaging 0.96
R0497:Brd2 UTSW 17 34114360 missense probably damaging 1.00
R0879:Brd2 UTSW 17 34113446 missense probably benign 0.03
R1150:Brd2 UTSW 17 34114007 utr 3 prime probably benign
R1152:Brd2 UTSW 17 34114007 utr 3 prime probably benign
R1280:Brd2 UTSW 17 34114150 missense possibly damaging 0.91
R2247:Brd2 UTSW 17 34114415 missense probably damaging 1.00
R3737:Brd2 UTSW 17 34117080 missense probably benign 0.10
R5286:Brd2 UTSW 17 34115231 missense probably damaging 0.97
R5673:Brd2 UTSW 17 34112607 unclassified probably benign
R6134:Brd2 UTSW 17 34113695 missense probably benign 0.00
R6318:Brd2 UTSW 17 34112898 missense probably damaging 1.00
R7257:Brd2 UTSW 17 34113822 missense probably damaging 1.00
R7493:Brd2 UTSW 17 34122257 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCATCGATCCCAATTCGGCCAC -3'
(R):5'- AAGATGCCAGATGAGCCACTGGAAC -3'

Sequencing Primer
(F):5'- CTGCCCGAAGCTATACAGG -3'
(R):5'- TGGAACCAGGACCTCTACCAG -3'
Posted On2014-03-14