Incidental Mutation 'R1432:Plxna2'
ID162276
Institutional Source Beutler Lab
Gene Symbol Plxna2
Ensembl Gene ENSMUSG00000026640
Gene Nameplexin A2
Synonyms2810428A13Rik, OCT, PlexA2, Plxn2
MMRRC Submission 039487-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1432 (G1)
Quality Score183
Status Validated
Chromosome1
Chromosomal Location194618218-194816869 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 194767463 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 830 (R830C)
Ref Sequence ENSEMBL: ENSMUSP00000027952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027952]
PDB Structure
Plexin A2 / Semaphorin 6A complex [X-RAY DIFFRACTION]
Mouse Plexin A2 extracellular domain [X-RAY DIFFRACTION]
Mouse Plexin A2, extracellular domains 1-4 [X-RAY DIFFRACTION]
Plexin A2 in complex with Semaphorin 6A [X-RAY DIFFRACTION]
Complex of mouse Plexin A2 - Semaphorin 3A - Neuropilin-1 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000027952
AA Change: R830C

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000027952
Gene: ENSMUSG00000026640
AA Change: R830C

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
Sema 50 492 1.65e-132 SMART
PSI 510 560 8e-12 SMART
PSI 655 702 6.35e-6 SMART
PSI 803 856 1.24e-8 SMART
IPT 857 952 6.36e-21 SMART
IPT 953 1038 1.02e-24 SMART
IPT 1040 1140 1.48e-21 SMART
IPT 1142 1237 8.81e-6 SMART
transmembrane domain 1238 1260 N/A INTRINSIC
Pfam:Plexin_cytopl 1311 1864 1.9e-261 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000135664
AA Change: R35C
SMART Domains Protein: ENSMUSP00000118087
Gene: ENSMUSG00000026640
AA Change: R35C

DomainStartEndE-ValueType
PSI 9 62 1.24e-8 SMART
Meta Mutation Damage Score 0.206 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.1%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plexin-A family of semaphorin co-receptors. Semaphorins are a large family of secreted or membrane-bound proteins that mediate repulsive effects on axon pathfinding during nervous system development. A subset of semaphorins are recognized by plexin-A/neuropilin transmembrane receptor complexes, triggering a cellular signal transduction cascade that leads to axon repulsion. This plexin-A family member is thought to transduce signals from semaphorin-3A and -3C. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show abnormal granule cell migration in the adult cerebellum and aberrant projection of mossy fibers in hippocampal slices. Mice homozygous for an ENU-induced allele are smaller and show granule cell migration defects and mild ataxia with incomplete penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,170,587 probably null Het
9130401M01Rik A T 15: 58,028,860 L117Q probably damaging Het
Abcb1b A G 5: 8,837,771 K886E possibly damaging Het
Acaa2 A T 18: 74,787,127 I9F probably damaging Het
Acap2 A T 16: 31,111,083 S386T probably damaging Het
Acsm2 A T 7: 119,573,575 I138F possibly damaging Het
Agl T C 3: 116,746,693 Y1424C probably damaging Het
Apc2 T C 10: 80,312,349 V1079A probably benign Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Armc8 C T 9: 99,523,132 probably benign Het
BC005561 T C 5: 104,518,104 F164S probably damaging Het
Catsperb A G 12: 101,622,217 Y953C probably damaging Het
Cdk13 G A 13: 17,718,416 A720V probably damaging Het
Chka T C 19: 3,874,809 probably benign Het
Clcc1 T C 3: 108,668,102 I165T probably benign Het
Cndp1 G A 18: 84,634,652 probably benign Het
Dip2c C A 13: 9,553,304 P297Q probably damaging Het
Dnah17 A T 11: 118,023,327 W4429R probably damaging Het
Doxl2 T A 6: 48,975,654 F171Y probably damaging Het
Dram2 T C 3: 106,570,766 V138A possibly damaging Het
Dus4l T C 12: 31,648,771 N78S probably benign Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Ebf1 T C 11: 45,004,706 probably benign Het
Epm2a T A 10: 11,390,843 Y111N probably damaging Het
Gm773 T C X: 56,202,017 T52A probably benign Het
Gpam C A 19: 55,079,261 M483I probably damaging Het
Gpr12 T C 5: 146,583,425 H229R probably damaging Het
Gpr149 T C 3: 62,531,018 T573A probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hells T A 19: 38,957,184 probably null Het
Herc1 T A 9: 66,465,469 N3102K probably benign Het
Herc3 A T 6: 58,916,842 T968S possibly damaging Het
Ift88 A G 14: 57,437,279 Y69C probably benign Het
Incenp G A 19: 9,885,526 T388M unknown Het
Jrkl A G 9: 13,245,332 F108S probably benign Het
Khdc1a A G 1: 21,350,318 E54G possibly damaging Het
Kif6 T A 17: 49,620,700 F58L probably damaging Het
Klk14 T C 7: 43,694,918 S218P probably damaging Het
Kmt2e T C 5: 23,450,321 M19T probably benign Het
Llgl1 G T 11: 60,708,554 G454C probably damaging Het
Lyrm4 A G 13: 36,092,915 V33A probably benign Het
Mcam C T 9: 44,141,291 R606C probably damaging Het
Mgam T A 6: 40,756,367 M692K probably damaging Het
Mkl2 A G 16: 13,401,002 N504S probably benign Het
Mmp28 C T 11: 83,442,939 R392H probably damaging Het
Mpdz G A 4: 81,292,551 T1699M probably damaging Het
Mrps11 T C 7: 78,783,562 probably benign Het
Msmo1 A G 8: 64,727,616 probably benign Het
Mst1 A G 9: 108,084,204 E571G probably benign Het
Myh14 T C 7: 44,616,299 E1585G probably damaging Het
Myrfl A G 10: 116,777,427 C824R probably damaging Het
Ncapd3 C T 9: 27,069,872 probably benign Het
Nlrp4a G GGTTCTTC 7: 26,464,197 probably null Het
Nos1 C T 5: 117,949,619 probably benign Het
Notch3 T C 17: 32,164,224 S47G probably benign Het
Npsr1 A G 9: 24,310,075 Y122C probably damaging Het
Olfr1335 T C 4: 118,809,238 M209V probably benign Het
Olfr339 C T 2: 36,421,643 L82F probably damaging Het
Olfr420 T A 1: 174,158,917 V48E possibly damaging Het
Olfr76 G T 19: 12,120,239 R158S possibly damaging Het
Olfr786 C T 10: 129,436,938 T42I probably damaging Het
Olfr877 T A 9: 37,855,252 L145M possibly damaging Het
Otog G T 7: 46,300,583 V2490F probably damaging Het
Pibf1 T C 14: 99,112,989 V191A probably benign Het
Pip A G 6: 41,849,918 M66V probably benign Het
Prkca A T 11: 107,939,520 V248E probably benign Het
Prmt7 T A 8: 106,237,284 L253* probably null Het
Prrc2a G T 17: 35,153,912 probably benign Het
Rasgrf1 A G 9: 90,012,800 D1091G probably benign Het
Rbm7 C A 9: 48,489,945 G161V probably benign Het
Scn1a A T 2: 66,322,429 I736N probably damaging Het
Skint6 A G 4: 112,869,524 probably benign Het
Slc22a2 C T 17: 12,584,308 H10Y possibly damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Stam2 A G 2: 52,714,809 probably benign Het
Stk40 T C 4: 126,136,833 L282P probably damaging Het
Tas2r110 A G 6: 132,868,368 N121D probably damaging Het
Tbc1d32 A G 10: 56,017,662 Y1272H probably damaging Het
Tmem131l T C 3: 83,928,714 D696G probably damaging Het
Trdmt1 T C 2: 13,519,846 Y266C probably damaging Het
Trim5 G T 7: 104,279,519 H72N probably benign Het
Trim5 A C 7: 104,279,521 L71R probably benign Het
Twf2 T A 9: 106,214,813 probably benign Het
Ubap2l T C 3: 90,019,328 T580A probably benign Het
Ugt1a10 C T 1: 88,216,260 R201C probably damaging Het
Unc5a A G 13: 55,004,472 probably benign Het
Vmn2r85 T C 10: 130,425,286 N394S possibly damaging Het
Wrn A T 8: 33,319,141 probably benign Het
Other mutations in Plxna2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Plxna2 APN 1 194644657 missense probably damaging 1.00
IGL00332:Plxna2 APN 1 194789830 missense probably damaging 0.98
IGL00392:Plxna2 APN 1 194800568 missense probably damaging 1.00
IGL00432:Plxna2 APN 1 194644096 missense probably benign 0.03
IGL00704:Plxna2 APN 1 194751461 missense probably damaging 0.99
IGL00737:Plxna2 APN 1 194746239 splice site probably benign
IGL01078:Plxna2 APN 1 194786693 unclassified probably benign
IGL01354:Plxna2 APN 1 194762435 missense probably benign 0.02
IGL01432:Plxna2 APN 1 194644318 missense possibly damaging 0.58
IGL01459:Plxna2 APN 1 194764570 missense probably benign 0.00
IGL01525:Plxna2 APN 1 194712311 missense probably benign 0.00
IGL01656:Plxna2 APN 1 194790161 missense possibly damaging 0.52
IGL01825:Plxna2 APN 1 194788902 missense probably damaging 0.98
IGL01862:Plxna2 APN 1 194643950 missense possibly damaging 0.87
IGL01899:Plxna2 APN 1 194751488 missense probably damaging 1.00
IGL01996:Plxna2 APN 1 194799776 missense probably damaging 0.99
IGL02123:Plxna2 APN 1 194794383 missense probably damaging 1.00
IGL02226:Plxna2 APN 1 194644424 missense probably damaging 1.00
IGL02227:Plxna2 APN 1 194752089 missense probably damaging 1.00
IGL02415:Plxna2 APN 1 194643964 missense probably damaging 1.00
IGL02440:Plxna2 APN 1 194746150 missense probably benign 0.10
IGL02545:Plxna2 APN 1 194786690 unclassified probably benign
IGL02553:Plxna2 APN 1 194751438 missense probably benign 0.08
IGL02882:Plxna2 APN 1 194762570 missense probably damaging 1.00
IGL02946:Plxna2 APN 1 194749309 splice site probably benign
IGL03062:Plxna2 APN 1 194762550 missense possibly damaging 0.72
IGL03095:Plxna2 APN 1 194801127 missense probably damaging 1.00
IGL03293:Plxna2 APN 1 194804945 missense probably damaging 0.99
PIT4514001:Plxna2 UTSW 1 194794937 missense probably benign 0.00
R0024:Plxna2 UTSW 1 194643995 missense possibly damaging 0.57
R0040:Plxna2 UTSW 1 194643896 missense probably benign 0.13
R0040:Plxna2 UTSW 1 194643896 missense probably benign 0.13
R0063:Plxna2 UTSW 1 194644939 missense probably benign 0.00
R0063:Plxna2 UTSW 1 194644939 missense probably benign 0.00
R0217:Plxna2 UTSW 1 194644598 missense probably damaging 1.00
R0316:Plxna2 UTSW 1 194644150 missense probably damaging 1.00
R0440:Plxna2 UTSW 1 194644404 nonsense probably null
R0505:Plxna2 UTSW 1 194644348 missense possibly damaging 0.93
R0568:Plxna2 UTSW 1 194751386 missense probably benign 0.00
R0669:Plxna2 UTSW 1 194788837 missense probably damaging 0.99
R0674:Plxna2 UTSW 1 194649475 missense probably benign 0.00
R0885:Plxna2 UTSW 1 194644556 missense probably benign
R0898:Plxna2 UTSW 1 194797024 missense probably damaging 1.00
R0940:Plxna2 UTSW 1 194800555 missense probably benign 0.01
R1061:Plxna2 UTSW 1 194644093 missense probably damaging 1.00
R1067:Plxna2 UTSW 1 194780510 splice site probably null
R1222:Plxna2 UTSW 1 194800649 missense probably damaging 1.00
R1345:Plxna2 UTSW 1 194644486 missense probably damaging 1.00
R1363:Plxna2 UTSW 1 194804939 nonsense probably null
R1434:Plxna2 UTSW 1 194751540 splice site probably benign
R1597:Plxna2 UTSW 1 194749306 splice site probably benign
R1719:Plxna2 UTSW 1 194644370 missense possibly damaging 0.93
R1778:Plxna2 UTSW 1 194810970 missense probably benign 0.01
R1795:Plxna2 UTSW 1 194806303 missense probably damaging 0.99
R1819:Plxna2 UTSW 1 194790186 missense probably benign 0.03
R1926:Plxna2 UTSW 1 194762450 missense probably benign 0.02
R1966:Plxna2 UTSW 1 194644700 missense possibly damaging 0.91
R1987:Plxna2 UTSW 1 194643989 missense probably damaging 1.00
R1988:Plxna2 UTSW 1 194643989 missense probably damaging 1.00
R2034:Plxna2 UTSW 1 194780594 missense probably benign 0.00
R2131:Plxna2 UTSW 1 194644750 missense probably benign 0.01
R2171:Plxna2 UTSW 1 194800617 missense probably damaging 1.00
R2217:Plxna2 UTSW 1 194797748 missense probably damaging 1.00
R2311:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2340:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2342:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2423:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2424:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2425:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2842:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2971:Plxna2 UTSW 1 194797731 missense probably damaging 1.00
R3236:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R3731:Plxna2 UTSW 1 194788885 missense probably benign 0.42
R3783:Plxna2 UTSW 1 194807521 missense probably damaging 1.00
R3784:Plxna2 UTSW 1 194644617 missense probably benign
R3787:Plxna2 UTSW 1 194643934 missense probably benign 0.10
R3845:Plxna2 UTSW 1 194793790 missense probably damaging 0.96
R3927:Plxna2 UTSW 1 194746157 missense probably benign 0.02
R3930:Plxna2 UTSW 1 194794910 missense probably benign 0.17
R3964:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R3980:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4067:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4120:Plxna2 UTSW 1 194780627 missense probably damaging 1.00
R4231:Plxna2 UTSW 1 194644454 missense probably damaging 1.00
R4257:Plxna2 UTSW 1 194644775 missense probably damaging 1.00
R4396:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4397:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4418:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4444:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4446:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4482:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4487:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4489:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4571:Plxna2 UTSW 1 194810988 missense possibly damaging 0.91
R4622:Plxna2 UTSW 1 194812150 missense probably benign
R4623:Plxna2 UTSW 1 194812150 missense probably benign
R4684:Plxna2 UTSW 1 194762594 missense probably benign 0.42
R4688:Plxna2 UTSW 1 194644445 missense probably damaging 1.00
R4855:Plxna2 UTSW 1 194797732 missense probably benign 0.39
R4876:Plxna2 UTSW 1 194643775 missense probably benign 0.02
R5161:Plxna2 UTSW 1 194751404 missense probably benign
R5207:Plxna2 UTSW 1 194788899 missense probably benign 0.19
R5479:Plxna2 UTSW 1 194793873 missense probably benign
R5931:Plxna2 UTSW 1 194810870 missense probably damaging 1.00
R6026:Plxna2 UTSW 1 194799814 missense probably damaging 1.00
R6029:Plxna2 UTSW 1 194794427 missense probably benign 0.00
R6029:Plxna2 UTSW 1 194799575 missense probably damaging 1.00
R6059:Plxna2 UTSW 1 194810971 missense possibly damaging 0.79
R6238:Plxna2 UTSW 1 194790196 missense probably benign 0.01
R6322:Plxna2 UTSW 1 194754367 missense possibly damaging 0.89
R6668:Plxna2 UTSW 1 194810088 missense possibly damaging 0.68
R6709:Plxna2 UTSW 1 194789766 missense probably benign 0.01
R6748:Plxna2 UTSW 1 194794182 intron probably null
R6838:Plxna2 UTSW 1 194804914 missense possibly damaging 0.90
R6844:Plxna2 UTSW 1 194793828 missense probably benign 0.08
R7069:Plxna2 UTSW 1 194793904 missense possibly damaging 0.51
R7122:Plxna2 UTSW 1 194644568 nonsense probably null
R7145:Plxna2 UTSW 1 194649522 missense probably benign 0.31
R7189:Plxna2 UTSW 1 194801058 missense possibly damaging 0.58
R7207:Plxna2 UTSW 1 194644019 missense probably damaging 1.00
R7232:Plxna2 UTSW 1 194712260 missense probably damaging 1.00
R7234:Plxna2 UTSW 1 194806390 missense probably damaging 0.96
R7246:Plxna2 UTSW 1 194644282 missense possibly damaging 0.74
R7255:Plxna2 UTSW 1 194752103 missense probably benign 0.03
R7283:Plxna2 UTSW 1 194644883 missense probably damaging 0.99
R7288:Plxna2 UTSW 1 194796919 missense probably damaging 1.00
R7361:Plxna2 UTSW 1 194799779 missense probably damaging 1.00
R7424:Plxna2 UTSW 1 194806339 missense probably damaging 0.98
X0027:Plxna2 UTSW 1 194644433 missense probably damaging 1.00
Z1088:Plxna2 UTSW 1 194644441 missense possibly damaging 0.56
Z1088:Plxna2 UTSW 1 194764539 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GACTGCCTAAGGCACCCTATTCAC -3'
(R):5'- GACTCAGTCAACCTAGTCATGCAGC -3'

Sequencing Primer
(F):5'- GGGTGGTGACCCCAATG -3'
(R):5'- CATCAAATATTCCGTGTCCAGGG -3'
Posted On2014-03-14