Incidental Mutation 'R1387:Col6a3'
ID162397
Institutional Source Beutler Lab
Gene Symbol Col6a3
Ensembl Gene ENSMUSG00000048126
Gene Namecollagen, type VI, alpha 3
SynonymsCol6a-3
MMRRC Submission 039449-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1387 (G1)
Quality Score203
Status Validated
Chromosome1
Chromosomal Location90765923-90843971 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 90822416 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056925] [ENSMUST00000097653] [ENSMUST00000130846] [ENSMUST00000187753] [ENSMUST00000188587]
Predicted Effect probably benign
Transcript: ENSMUST00000056925
SMART Domains Protein: ENSMUSP00000057131
Gene: ENSMUSG00000048126

DomainStartEndE-ValueType
VWA 36 214 3.58e-42 SMART
VWA 239 415 3.34e-42 SMART
VWA 442 617 7.27e-43 SMART
VWA 636 813 7.8e-43 SMART
VWA 834 1010 4.21e-39 SMART
VWA 1024 1203 3.02e-40 SMART
VWA 1228 1406 1.1e-42 SMART
VWA 1431 1604 9.17e-40 SMART
VWA 1634 1807 1.78e-37 SMART
VWA 1833 2022 7.92e-3 SMART
Pfam:Collagen 2033 2094 2e-10 PFAM
Pfam:Collagen 2077 2142 2.8e-10 PFAM
low complexity region 2179 2222 N/A INTRINSIC
low complexity region 2228 2279 N/A INTRINSIC
Pfam:Collagen 2311 2373 7.9e-11 PFAM
VWA 2397 2576 3.95e-21 SMART
VWA 2614 2813 2.25e-25 SMART
low complexity region 2864 2880 N/A INTRINSIC
low complexity region 2886 2900 N/A INTRINSIC
low complexity region 2903 2941 N/A INTRINSIC
low complexity region 2945 3024 N/A INTRINSIC
low complexity region 3039 3076 N/A INTRINSIC
low complexity region 3091 3103 N/A INTRINSIC
FN3 3104 3183 4.6e-1 SMART
KU 3226 3279 4.34e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097653
SMART Domains Protein: ENSMUSP00000137585
Gene: ENSMUSG00000048126

DomainStartEndE-ValueType
VWA 35 210 7.27e-43 SMART
VWA 227 403 4.21e-39 SMART
VWA 417 596 3.02e-40 SMART
VWA 621 799 1.1e-42 SMART
VWA 824 997 9.17e-40 SMART
VWA 1027 1200 1.78e-37 SMART
VWA 1226 1415 7.92e-3 SMART
Pfam:Collagen 1426 1486 9.2e-10 PFAM
Pfam:Collagen 1473 1539 2.2e-9 PFAM
low complexity region 1572 1615 N/A INTRINSIC
low complexity region 1621 1672 N/A INTRINSIC
low complexity region 1690 1704 N/A INTRINSIC
low complexity region 1713 1734 N/A INTRINSIC
VWA 1790 1969 3.95e-21 SMART
VWA 2007 2206 2.25e-25 SMART
low complexity region 2257 2273 N/A INTRINSIC
low complexity region 2279 2293 N/A INTRINSIC
low complexity region 2296 2334 N/A INTRINSIC
low complexity region 2338 2417 N/A INTRINSIC
low complexity region 2432 2469 N/A INTRINSIC
low complexity region 2484 2496 N/A INTRINSIC
FN3 2497 2576 4.6e-1 SMART
KU 2619 2672 4.34e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130846
SMART Domains Protein: ENSMUSP00000115210
Gene: ENSMUSG00000048126

DomainStartEndE-ValueType
VWA 36 214 3.58e-42 SMART
VWA 239 415 3.34e-42 SMART
VWA 442 617 7.27e-43 SMART
VWA 636 813 7.8e-43 SMART
VWA 834 1010 4.21e-39 SMART
VWA 1024 1203 3.02e-40 SMART
VWA 1228 1406 1.1e-42 SMART
VWA 1431 1604 9.17e-40 SMART
Pfam:VWA 1636 1703 1.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187753
SMART Domains Protein: ENSMUSP00000140280
Gene: ENSMUSG00000048126

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:VWA 35 74 1.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188587
SMART Domains Protein: ENSMUSP00000140858
Gene: ENSMUSG00000048126

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWA 35 210 4.7e-45 SMART
VWA 227 403 2.7e-41 SMART
VWA 417 596 2e-42 SMART
VWA 621 799 7e-45 SMART
VWA 824 997 5.8e-42 SMART
VWA 1027 1200 1.1e-39 SMART
VWA 1226 1415 4.8e-5 SMART
Pfam:Collagen 1426 1486 3.8e-8 PFAM
Pfam:Collagen 1473 1539 9.1e-8 PFAM
low complexity region 1572 1615 N/A INTRINSIC
low complexity region 1621 1672 N/A INTRINSIC
low complexity region 1690 1704 N/A INTRINSIC
low complexity region 1713 1734 N/A INTRINSIC
VWA 1790 1969 2.4e-23 SMART
VWA 2007 2206 1.4e-27 SMART
low complexity region 2257 2273 N/A INTRINSIC
low complexity region 2279 2293 N/A INTRINSIC
low complexity region 2296 2334 N/A INTRINSIC
low complexity region 2338 2417 N/A INTRINSIC
low complexity region 2432 2469 N/A INTRINSIC
low complexity region 2484 2496 N/A INTRINSIC
FN3 2497 2576 2.2e-3 SMART
KU 2619 2672 2.1e-26 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.4%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha-3 chain, one of the three alpha chains of type VI collagen, a beaded filament collagen found in most connective tissues. The alpha-3 chain of type VI collagen is much larger than the alpha-1 and -2 chains. This difference in size is largely due to an increase in the number of subdomains, similar to von Willebrand Factor type A domains, that are found in the amino terminal globular domain of all the alpha chains. These domains have been shown to bind extracellular matrix proteins, an interaction that explains the importance of this collagen in organizing matrix components. Mutations in the type VI collagen genes are associated with Bethlem myopathy, a rare autosomal dominant proximal myopathy with early childhood onset. Mutations in this gene are also a cause of Ullrich congenital muscular dystrophy, also referred to as Ullrich scleroatonic muscular dystrophy, an autosomal recessive congenital myopathy that is more severe than Bethlem myopathy. Multiple transcript variants have been identified, but the full-length nature of only some of these variants has been described. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit mild myopathy, decreased skeletal muscle weight, increased collagen deposition in muscles, skeletal muscle interstitial fibrosis and abnormal tendon collagen fibril morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610303G11Rik T A 9: 98,186,759 noncoding transcript Het
4930447C04Rik C A 12: 72,915,434 R52L probably benign Het
9930021J03Rik A G 19: 29,723,453 I812T probably benign Het
Abca13 C T 11: 9,682,085 Q5002* probably null Het
Acacb T C 5: 114,200,512 I761T probably benign Het
Acap3 G T 4: 155,899,480 L134F probably benign Het
Adamtsl1 T C 4: 86,374,993 probably benign Het
Adgrv1 A G 13: 81,493,176 V3278A possibly damaging Het
Agxt2 T C 15: 10,380,610 Y196H probably damaging Het
Akap13 T C 7: 75,586,193 V172A probably damaging Het
Aqp8 A G 7: 123,466,668 I229V probably benign Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Cacng8 T C 7: 3,415,156 S275P possibly damaging Het
Catsperg1 T C 7: 29,206,864 Y138C probably damaging Het
Ccdc93 T G 1: 121,491,189 L491R probably damaging Het
Cntnap2 T C 6: 47,107,914 V1103A probably benign Het
Col12a1 C T 9: 79,681,375 probably benign Het
Csf2rb2 C T 15: 78,298,214 A6T probably damaging Het
Cyp2j5 T A 4: 96,634,285 S351C probably damaging Het
Cyth1 A G 11: 118,182,346 probably benign Het
Dock2 A G 11: 34,273,309 probably benign Het
Duoxa1 T A 2: 122,303,987 I262F possibly damaging Het
Dync2h1 T C 9: 7,125,816 D1930G probably benign Het
Elmsan1 C A 12: 84,152,931 R1005L probably damaging Het
Eno1 C T 4: 150,248,133 probably benign Het
Fam102a T C 2: 32,565,623 S254P possibly damaging Het
Fam98a T A 17: 75,538,269 H494L unknown Het
Fcamr C A 1: 130,804,642 T122K possibly damaging Het
Foxq1 A G 13: 31,559,305 D130G probably damaging Het
Glb1 T A 9: 114,420,363 W5R probably damaging Het
Gm17661 GA GAA 2: 90,917,709 noncoding transcript Het
Gm5431 T A 11: 48,895,015 R178W possibly damaging Het
Gys2 C T 6: 142,461,283 V116M probably benign Het
Hif1a C T 12: 73,942,292 T651I possibly damaging Het
Itgb5 T A 16: 33,900,515 Y3* probably null Het
Kank3 A G 17: 33,816,231 N7S possibly damaging Het
Kdm2b G T 5: 122,880,268 H981Q probably damaging Het
Kdm6a C T X: 18,253,996 probably benign Het
Kif1a A T 1: 93,055,950 probably benign Het
Knl1 T A 2: 119,070,730 S971T possibly damaging Het
Lcn6 T C 2: 25,677,137 V50A possibly damaging Het
Llgl2 G T 11: 115,853,132 V762F probably damaging Het
Lpcat4 T C 2: 112,244,676 F342L probably benign Het
Lrp2 C A 2: 69,456,918 G3725V probably damaging Het
Map1b T C 13: 99,432,650 T1188A unknown Het
Mecp2 G A X: 74,035,788 P362S possibly damaging Het
Mmp13 T A 9: 7,282,033 F445Y possibly damaging Het
Myo5b G T 18: 74,644,201 probably benign Het
Myo7b A G 18: 31,983,752 probably benign Het
Nadk2 C A 15: 9,106,782 L384I possibly damaging Het
Napg A G 18: 62,986,212 I98V possibly damaging Het
Ncoa1 G T 12: 4,274,790 N1041K probably benign Het
Nmu A T 5: 76,350,145 C64* probably null Het
Nobox T A 6: 43,307,198 K13M probably damaging Het
Nos1 T C 5: 117,953,783 probably benign Het
Nrg2 A G 18: 36,196,739 V141A probably damaging Het
Olfr170 T C 16: 19,606,027 I214V probably damaging Het
Olfr362 T G 2: 37,104,868 I261L probably benign Het
Olfr544 T A 7: 102,484,704 I139L probably benign Het
Phldb2 C T 16: 45,825,994 E71K possibly damaging Het
Pik3r4 T A 9: 105,644,291 Y19N probably damaging Het
Pkhd1 A C 1: 20,555,223 probably benign Het
Pogk G T 1: 166,400,138 P148Q possibly damaging Het
Pten G T 19: 32,798,096 A79S probably benign Het
Ptpdc1 A T 13: 48,586,320 V545E possibly damaging Het
Qdpr G C 5: 45,450,138 probably benign Het
Rhbdd3 T A 11: 5,104,121 H83Q probably damaging Het
Rnf6 A G 5: 146,211,245 V321A probably benign Het
Rtf1 T A 2: 119,705,645 probably null Het
Serpina10 C T 12: 103,628,241 V240I probably benign Het
Siah2 A G 3: 58,691,514 V101A possibly damaging Het
Taok3 A G 5: 117,206,655 K46R probably damaging Het
Tcaf2 A C 6: 42,624,578 L849R probably damaging Het
Upf3a T C 8: 13,792,118 F178S probably damaging Het
Vmn1r218 G A 13: 23,137,308 G195D probably damaging Het
Vmn2r59 A G 7: 42,046,097 V297A probably damaging Het
Vmn2r70 T A 7: 85,558,761 Q836L probably benign Het
Zfp473 A G 7: 44,732,941 V655A probably benign Het
Zic5 A G 14: 122,459,485 S573P unknown Het
Other mutations in Col6a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Col6a3 APN 1 90828255 missense probably damaging 1.00
IGL00425:Col6a3 APN 1 90782026 missense unknown
IGL00541:Col6a3 APN 1 90802142 missense possibly damaging 0.83
IGL01063:Col6a3 APN 1 90802332 missense probably damaging 1.00
IGL01094:Col6a3 APN 1 90803933 missense possibly damaging 0.93
IGL01138:Col6a3 APN 1 90807510 missense probably damaging 1.00
IGL01291:Col6a3 APN 1 90802292 missense probably damaging 1.00
IGL01674:Col6a3 APN 1 90802514 missense probably damaging 1.00
IGL01756:Col6a3 APN 1 90779162 missense unknown
IGL01827:Col6a3 APN 1 90802319 missense probably damaging 1.00
IGL01845:Col6a3 APN 1 90796571 missense probably damaging 1.00
IGL01869:Col6a3 APN 1 90773048 missense unknown
IGL01900:Col6a3 APN 1 90795010 critical splice donor site probably null
IGL01925:Col6a3 APN 1 90802236 missense possibly damaging 0.95
IGL02002:Col6a3 APN 1 90782136 splice site probably benign
IGL02115:Col6a3 APN 1 90807651 missense probably damaging 0.99
IGL02302:Col6a3 APN 1 90781760 missense unknown
IGL02313:Col6a3 APN 1 90811606 missense probably damaging 1.00
IGL02458:Col6a3 APN 1 90779197 missense unknown
IGL02821:Col6a3 APN 1 90803878 missense probably damaging 1.00
IGL02828:Col6a3 APN 1 90796559 missense probably damaging 1.00
IGL03112:Col6a3 APN 1 90811520 nonsense probably null
IGL03129:Col6a3 APN 1 90821862 missense probably damaging 1.00
IGL03132:Col6a3 APN 1 90803893 missense probably damaging 1.00
IGL03148:Col6a3 APN 1 90827866 missense probably benign 0.33
IGL03251:Col6a3 APN 1 90810176 missense probably damaging 1.00
ANU05:Col6a3 UTSW 1 90802292 missense probably damaging 1.00
IGL03048:Col6a3 UTSW 1 90810248 missense possibly damaging 0.58
R0020:Col6a3 UTSW 1 90811550 missense probably damaging 0.99
R0020:Col6a3 UTSW 1 90811550 missense probably damaging 0.99
R0033:Col6a3 UTSW 1 90802245 missense probably damaging 1.00
R0033:Col6a3 UTSW 1 90802245 missense probably damaging 1.00
R0105:Col6a3 UTSW 1 90798161 missense possibly damaging 0.65
R0116:Col6a3 UTSW 1 90813551 missense probably damaging 1.00
R0167:Col6a3 UTSW 1 90798173 missense probably damaging 1.00
R0319:Col6a3 UTSW 1 90807704 missense possibly damaging 0.95
R0348:Col6a3 UTSW 1 90828049 missense probably damaging 1.00
R0365:Col6a3 UTSW 1 90788216 missense unknown
R0512:Col6a3 UTSW 1 90821798 intron probably benign
R0564:Col6a3 UTSW 1 90807734 missense probably damaging 1.00
R0635:Col6a3 UTSW 1 90808086 splice site probably null
R0667:Col6a3 UTSW 1 90828101 missense probably damaging 0.98
R0680:Col6a3 UTSW 1 90778981 missense unknown
R0736:Col6a3 UTSW 1 90804089 missense possibly damaging 0.95
R0737:Col6a3 UTSW 1 90828298 missense probably damaging 1.00
R0747:Col6a3 UTSW 1 90802653 missense probably damaging 1.00
R1155:Col6a3 UTSW 1 90794325 missense probably null 1.00
R1169:Col6a3 UTSW 1 90822014 missense possibly damaging 0.67
R1180:Col6a3 UTSW 1 90781855 missense unknown
R1225:Col6a3 UTSW 1 90811516 missense probably damaging 1.00
R1343:Col6a3 UTSW 1 90768347 missense unknown
R1437:Col6a3 UTSW 1 90801376 missense probably damaging 1.00
R1448:Col6a3 UTSW 1 90781855 missense unknown
R1677:Col6a3 UTSW 1 90821861 missense probably benign 0.14
R1681:Col6a3 UTSW 1 90773502 missense unknown
R1711:Col6a3 UTSW 1 90830213 missense probably damaging 1.00
R1727:Col6a3 UTSW 1 90796574 critical splice acceptor site probably null
R1736:Col6a3 UTSW 1 90779059 missense unknown
R1738:Col6a3 UTSW 1 90816361 missense probably damaging 1.00
R1742:Col6a3 UTSW 1 90813794 missense probably damaging 1.00
R1809:Col6a3 UTSW 1 90827949 missense probably damaging 1.00
R1851:Col6a3 UTSW 1 90807534 missense possibly damaging 0.69
R1852:Col6a3 UTSW 1 90807534 missense possibly damaging 0.69
R1872:Col6a3 UTSW 1 90830214 missense probably damaging 0.96
R1889:Col6a3 UTSW 1 90803711 missense probably benign 0.00
R1895:Col6a3 UTSW 1 90803711 missense probably benign 0.00
R1908:Col6a3 UTSW 1 90811699 missense probably damaging 1.00
R1919:Col6a3 UTSW 1 90822359 missense possibly damaging 0.66
R1973:Col6a3 UTSW 1 90804175 missense probably damaging 1.00
R2083:Col6a3 UTSW 1 90782011 missense unknown
R2121:Col6a3 UTSW 1 90810365 missense probably damaging 1.00
R2197:Col6a3 UTSW 1 90803745 missense probably benign 0.09
R2448:Col6a3 UTSW 1 90813358 missense probably damaging 1.00
R2831:Col6a3 UTSW 1 90803713 missense possibly damaging 0.89
R2877:Col6a3 UTSW 1 90775599 missense unknown
R3052:Col6a3 UTSW 1 90802130 missense possibly damaging 0.71
R3104:Col6a3 UTSW 1 90816302 missense probably damaging 0.99
R3105:Col6a3 UTSW 1 90816302 missense probably damaging 0.99
R3106:Col6a3 UTSW 1 90816302 missense probably damaging 0.99
R3418:Col6a3 UTSW 1 90804091 missense probably benign 0.42
R3419:Col6a3 UTSW 1 90804091 missense probably benign 0.42
R3837:Col6a3 UTSW 1 90780081 missense unknown
R4007:Col6a3 UTSW 1 90802569 missense probably damaging 1.00
R4082:Col6a3 UTSW 1 90821883 missense probably damaging 1.00
R4181:Col6a3 UTSW 1 90807614 missense probably damaging 1.00
R4200:Col6a3 UTSW 1 90801383 missense probably benign 0.28
R4244:Col6a3 UTSW 1 90786639 missense unknown
R4297:Col6a3 UTSW 1 90811378 missense probably damaging 1.00
R4302:Col6a3 UTSW 1 90807614 missense probably damaging 1.00
R4472:Col6a3 UTSW 1 90822014 missense probably benign 0.23
R4600:Col6a3 UTSW 1 90781904 missense unknown
R4683:Col6a3 UTSW 1 90773457 missense unknown
R4788:Col6a3 UTSW 1 90772950 critical splice donor site probably null
R4851:Col6a3 UTSW 1 90779289 missense unknown
R4899:Col6a3 UTSW 1 90802427 missense probably damaging 0.99
R4904:Col6a3 UTSW 1 90801442 missense probably damaging 1.00
R4908:Col6a3 UTSW 1 90807524 missense probably damaging 1.00
R4960:Col6a3 UTSW 1 90804218 missense probably damaging 1.00
R4981:Col6a3 UTSW 1 90778843 missense unknown
R5057:Col6a3 UTSW 1 90816130 missense possibly damaging 0.91
R5062:Col6a3 UTSW 1 90779352 missense unknown
R5105:Col6a3 UTSW 1 90798140 missense possibly damaging 0.81
R5127:Col6a3 UTSW 1 90768345 missense unknown
R5166:Col6a3 UTSW 1 90810608 missense probably damaging 1.00
R5168:Col6a3 UTSW 1 90773639 nonsense probably null
R5196:Col6a3 UTSW 1 90816538 splice site probably null
R5230:Col6a3 UTSW 1 90789054 missense unknown
R5268:Col6a3 UTSW 1 90785243 missense unknown
R5381:Col6a3 UTSW 1 90775612 missense unknown
R5392:Col6a3 UTSW 1 90801295 missense probably benign 0.41
R5445:Col6a3 UTSW 1 90782039 nonsense probably null
R5571:Col6a3 UTSW 1 90788216 missense unknown
R5665:Col6a3 UTSW 1 90827880 missense probably benign 0.00
R5902:Col6a3 UTSW 1 90802199 unclassified probably null
R5914:Col6a3 UTSW 1 90776200 missense unknown
R5955:Col6a3 UTSW 1 90811441 missense probably damaging 1.00
R5977:Col6a3 UTSW 1 90821849 missense possibly damaging 0.82
R6006:Col6a3 UTSW 1 90768383 missense unknown
R6010:Col6a3 UTSW 1 90773497 missense unknown
R6025:Col6a3 UTSW 1 90828102 missense probably damaging 1.00
R6151:Col6a3 UTSW 1 90813753 missense possibly damaging 0.53
R6154:Col6a3 UTSW 1 90773665 missense unknown
R6181:Col6a3 UTSW 1 90816374 missense possibly damaging 0.95
R6197:Col6a3 UTSW 1 90822341 missense probably damaging 1.00
R6332:Col6a3 UTSW 1 90822233 missense probably damaging 1.00
R6362:Col6a3 UTSW 1 90810563 missense probably damaging 0.99
R6476:Col6a3 UTSW 1 90781812 missense unknown
R6484:Col6a3 UTSW 1 90791923 critical splice donor site probably null
R6701:Col6a3 UTSW 1 90792462 missense probably benign 0.14
R6702:Col6a3 UTSW 1 90779439 missense unknown
R6703:Col6a3 UTSW 1 90779439 missense unknown
R6703:Col6a3 UTSW 1 90792462 missense probably benign 0.14
R6724:Col6a3 UTSW 1 90779152 missense unknown
R6746:Col6a3 UTSW 1 90779045 missense unknown
R6797:Col6a3 UTSW 1 90804088 missense probably damaging 0.99
R6798:Col6a3 UTSW 1 90795009 splice site probably null
R6903:Col6a3 UTSW 1 90794207 missense probably damaging 1.00
R6925:Col6a3 UTSW 1 90816002 missense probably benign 0.00
R6978:Col6a3 UTSW 1 90807470 critical splice donor site probably null
R7058:Col6a3 UTSW 1 90828037 nonsense probably null
X0024:Col6a3 UTSW 1 90803637 critical splice donor site probably null
X0063:Col6a3 UTSW 1 90803905 missense probably damaging 1.00
X0067:Col6a3 UTSW 1 90811529 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTAGCCTGCTTCAGAGCTACCAC -3'
(R):5'- TTCAACCACGATCCCTGAGACATTG -3'

Sequencing Primer
(F):5'- CGAGTGAAGTGATTCTCCACTAC -3'
(R):5'- TGATAGCCGGGATGATGCATG -3'
Posted On2014-03-17