Incidental Mutation 'R1387:Zfp473'
ID162426
Institutional Source Beutler Lab
Gene Symbol Zfp473
Ensembl Gene ENSMUSG00000048012
Gene Namezinc finger protein 473
SynonymsD030014N22Rik
MMRRC Submission 039449-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R1387 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location44731480-44751050 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44732941 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 655 (V655A)
Ref Sequence ENSEMBL: ENSMUSP00000113789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060270] [ENSMUST00000118162] [ENSMUST00000120074] [ENSMUST00000120798] [ENSMUST00000126366] [ENSMUST00000140599] [ENSMUST00000149011]
Predicted Effect probably benign
Transcript: ENSMUST00000060270
AA Change: V656A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000051069
Gene: ENSMUSG00000048012
AA Change: V656A

DomainStartEndE-ValueType
KRAB 23 84 8.77e-3 SMART
ZnF_C2H2 209 231 1.18e-2 SMART
ZnF_C2H2 265 287 8.47e-4 SMART
ZnF_C2H2 377 399 2.4e-3 SMART
ZnF_C2H2 404 426 8.31e0 SMART
ZnF_C2H2 432 454 1.64e-1 SMART
ZnF_C2H2 460 482 1.98e-4 SMART
ZnF_C2H2 488 510 3.44e-4 SMART
ZnF_C2H2 516 538 2.57e-3 SMART
ZnF_C2H2 544 566 3.29e-1 SMART
ZnF_C2H2 572 594 2.29e0 SMART
ZnF_C2H2 697 719 1.47e1 SMART
ZnF_C2H2 725 747 1.04e-3 SMART
ZnF_C2H2 753 775 3.39e-3 SMART
ZnF_C2H2 781 803 2.24e-3 SMART
ZnF_C2H2 809 831 5.99e-4 SMART
ZnF_C2H2 837 859 1.36e-2 SMART
ZnF_C2H2 865 887 2.57e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118162
AA Change: V655A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113316
Gene: ENSMUSG00000048012
AA Change: V655A

DomainStartEndE-ValueType
KRAB 23 83 7.75e-3 SMART
ZnF_C2H2 208 230 1.18e-2 SMART
ZnF_C2H2 264 286 8.47e-4 SMART
ZnF_C2H2 376 398 2.4e-3 SMART
ZnF_C2H2 403 425 8.31e0 SMART
ZnF_C2H2 431 453 1.64e-1 SMART
ZnF_C2H2 459 481 1.98e-4 SMART
ZnF_C2H2 487 509 3.44e-4 SMART
ZnF_C2H2 515 537 2.57e-3 SMART
ZnF_C2H2 543 565 3.29e-1 SMART
ZnF_C2H2 571 593 2.29e0 SMART
ZnF_C2H2 696 718 1.47e1 SMART
ZnF_C2H2 724 746 1.04e-3 SMART
ZnF_C2H2 752 774 3.39e-3 SMART
ZnF_C2H2 780 802 2.24e-3 SMART
ZnF_C2H2 808 830 5.99e-4 SMART
ZnF_C2H2 836 858 1.36e-2 SMART
ZnF_C2H2 864 886 2.57e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120074
AA Change: V656A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113774
Gene: ENSMUSG00000048012
AA Change: V656A

DomainStartEndE-ValueType
KRAB 23 84 8.77e-3 SMART
ZnF_C2H2 209 231 1.18e-2 SMART
ZnF_C2H2 265 287 8.47e-4 SMART
ZnF_C2H2 377 399 2.4e-3 SMART
ZnF_C2H2 404 426 8.31e0 SMART
ZnF_C2H2 432 454 1.64e-1 SMART
ZnF_C2H2 460 482 1.98e-4 SMART
ZnF_C2H2 488 510 3.44e-4 SMART
ZnF_C2H2 516 538 2.57e-3 SMART
ZnF_C2H2 544 566 3.29e-1 SMART
ZnF_C2H2 572 594 2.29e0 SMART
ZnF_C2H2 697 719 1.47e1 SMART
ZnF_C2H2 725 747 1.04e-3 SMART
ZnF_C2H2 753 775 3.39e-3 SMART
ZnF_C2H2 781 803 2.24e-3 SMART
ZnF_C2H2 809 831 5.99e-4 SMART
ZnF_C2H2 837 859 1.36e-2 SMART
ZnF_C2H2 865 887 2.57e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120798
AA Change: V655A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113789
Gene: ENSMUSG00000048012
AA Change: V655A

DomainStartEndE-ValueType
KRAB 23 83 7.75e-3 SMART
ZnF_C2H2 208 230 1.18e-2 SMART
ZnF_C2H2 264 286 8.47e-4 SMART
ZnF_C2H2 376 398 2.4e-3 SMART
ZnF_C2H2 403 425 8.31e0 SMART
ZnF_C2H2 431 453 1.64e-1 SMART
ZnF_C2H2 459 481 1.98e-4 SMART
ZnF_C2H2 487 509 3.44e-4 SMART
ZnF_C2H2 515 537 2.57e-3 SMART
ZnF_C2H2 543 565 3.29e-1 SMART
ZnF_C2H2 571 593 2.29e0 SMART
ZnF_C2H2 696 718 1.47e1 SMART
ZnF_C2H2 724 746 1.04e-3 SMART
ZnF_C2H2 752 774 3.39e-3 SMART
ZnF_C2H2 780 802 2.24e-3 SMART
ZnF_C2H2 808 830 5.99e-4 SMART
ZnF_C2H2 836 858 1.36e-2 SMART
ZnF_C2H2 864 886 2.57e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126366
SMART Domains Protein: ENSMUSP00000127101
Gene: ENSMUSG00000048012

DomainStartEndE-ValueType
KRAB 23 84 8.77e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140599
SMART Domains Protein: ENSMUSP00000127738
Gene: ENSMUSG00000048012

DomainStartEndE-ValueType
KRAB 23 84 8.77e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149011
SMART Domains Protein: ENSMUSP00000130689
Gene: ENSMUSG00000048012

DomainStartEndE-ValueType
KRAB 23 84 8.77e-3 SMART
Meta Mutation Damage Score 0.1192 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.4%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Krueppel C2H2-type zinc-finger family of proteins. The encoded protein, a component of the U7 snRNP complex, plays a role in histone 3'-end pre-mRNA processing and may be required for cell cycle progression to S phase. Expression level and methylation status of this gene may be correlated with bone mineral density. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610303G11Rik T A 9: 98,186,759 noncoding transcript Het
4930447C04Rik C A 12: 72,915,434 R52L probably benign Het
9930021J03Rik A G 19: 29,723,453 I812T probably benign Het
Abca13 C T 11: 9,682,085 Q5002* probably null Het
Acacb T C 5: 114,200,512 I761T probably benign Het
Acap3 G T 4: 155,899,480 L134F probably benign Het
Adamtsl1 T C 4: 86,374,993 probably benign Het
Adgrv1 A G 13: 81,493,176 V3278A possibly damaging Het
Agxt2 T C 15: 10,380,610 Y196H probably damaging Het
Akap13 T C 7: 75,586,193 V172A probably damaging Het
Aqp8 A G 7: 123,466,668 I229V probably benign Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Cacng8 T C 7: 3,415,156 S275P possibly damaging Het
Catsperg1 T C 7: 29,206,864 Y138C probably damaging Het
Ccdc93 T G 1: 121,491,189 L491R probably damaging Het
Cntnap2 T C 6: 47,107,914 V1103A probably benign Het
Col12a1 C T 9: 79,681,375 probably benign Het
Col6a3 A G 1: 90,822,416 probably benign Het
Csf2rb2 C T 15: 78,298,214 A6T probably damaging Het
Cyp2j5 T A 4: 96,634,285 S351C probably damaging Het
Cyth1 A G 11: 118,182,346 probably benign Het
Dock2 A G 11: 34,273,309 probably benign Het
Duoxa1 T A 2: 122,303,987 I262F possibly damaging Het
Dync2h1 T C 9: 7,125,816 D1930G probably benign Het
Elmsan1 C A 12: 84,152,931 R1005L probably damaging Het
Eno1 C T 4: 150,248,133 probably benign Het
Fam102a T C 2: 32,565,623 S254P possibly damaging Het
Fam98a T A 17: 75,538,269 H494L unknown Het
Fcamr C A 1: 130,804,642 T122K possibly damaging Het
Foxq1 A G 13: 31,559,305 D130G probably damaging Het
Glb1 T A 9: 114,420,363 W5R probably damaging Het
Gm17661 GA GAA 2: 90,917,709 noncoding transcript Het
Gm5431 T A 11: 48,895,015 R178W possibly damaging Het
Gys2 C T 6: 142,461,283 V116M probably benign Het
Hif1a C T 12: 73,942,292 T651I possibly damaging Het
Itgb5 T A 16: 33,900,515 Y3* probably null Het
Kank3 A G 17: 33,816,231 N7S possibly damaging Het
Kdm2b G T 5: 122,880,268 H981Q probably damaging Het
Kdm6a C T X: 18,253,996 probably benign Het
Kif1a A T 1: 93,055,950 probably benign Het
Knl1 T A 2: 119,070,730 S971T possibly damaging Het
Lcn6 T C 2: 25,677,137 V50A possibly damaging Het
Llgl2 G T 11: 115,853,132 V762F probably damaging Het
Lpcat4 T C 2: 112,244,676 F342L probably benign Het
Lrp2 C A 2: 69,456,918 G3725V probably damaging Het
Map1b T C 13: 99,432,650 T1188A unknown Het
Mecp2 G A X: 74,035,788 P362S possibly damaging Het
Mmp13 T A 9: 7,282,033 F445Y possibly damaging Het
Myo5b G T 18: 74,644,201 probably benign Het
Myo7b A G 18: 31,983,752 probably benign Het
Nadk2 C A 15: 9,106,782 L384I possibly damaging Het
Napg A G 18: 62,986,212 I98V possibly damaging Het
Ncoa1 G T 12: 4,274,790 N1041K probably benign Het
Nmu A T 5: 76,350,145 C64* probably null Het
Nobox T A 6: 43,307,198 K13M probably damaging Het
Nos1 T C 5: 117,953,783 probably benign Het
Nrg2 A G 18: 36,196,739 V141A probably damaging Het
Olfr170 T C 16: 19,606,027 I214V probably damaging Het
Olfr362 T G 2: 37,104,868 I261L probably benign Het
Olfr544 T A 7: 102,484,704 I139L probably benign Het
Phldb2 C T 16: 45,825,994 E71K possibly damaging Het
Pik3r4 T A 9: 105,644,291 Y19N probably damaging Het
Pkhd1 A C 1: 20,555,223 probably benign Het
Pogk G T 1: 166,400,138 P148Q possibly damaging Het
Pten G T 19: 32,798,096 A79S probably benign Het
Ptpdc1 A T 13: 48,586,320 V545E possibly damaging Het
Qdpr G C 5: 45,450,138 probably benign Het
Rhbdd3 T A 11: 5,104,121 H83Q probably damaging Het
Rnf6 A G 5: 146,211,245 V321A probably benign Het
Rtf1 T A 2: 119,705,645 probably null Het
Serpina10 C T 12: 103,628,241 V240I probably benign Het
Siah2 A G 3: 58,691,514 V101A possibly damaging Het
Taok3 A G 5: 117,206,655 K46R probably damaging Het
Tcaf2 A C 6: 42,624,578 L849R probably damaging Het
Upf3a T C 8: 13,792,118 F178S probably damaging Het
Vmn1r218 G A 13: 23,137,308 G195D probably damaging Het
Vmn2r59 A G 7: 42,046,097 V297A probably damaging Het
Vmn2r70 T A 7: 85,558,761 Q836L probably benign Het
Zic5 A G 14: 122,459,485 S573P unknown Het
Other mutations in Zfp473
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01153:Zfp473 APN 7 44734568 missense probably damaging 1.00
IGL01443:Zfp473 APN 7 44739563 missense probably damaging 0.99
IGL01459:Zfp473 APN 7 44739563 missense probably damaging 0.99
IGL01905:Zfp473 APN 7 44733727 missense probably benign 0.00
IGL02027:Zfp473 APN 7 44738038 splice site probably benign
IGL02314:Zfp473 APN 7 44733929 missense probably benign 0.00
IGL02445:Zfp473 APN 7 44733683 missense probably damaging 1.00
IGL03033:Zfp473 APN 7 44733098 missense probably benign 0.05
R0037:Zfp473 UTSW 7 44733900 missense probably damaging 0.96
R0054:Zfp473 UTSW 7 44734475 missense probably damaging 0.99
R0054:Zfp473 UTSW 7 44734475 missense probably damaging 0.99
R0190:Zfp473 UTSW 7 44733188 missense probably damaging 1.00
R1178:Zfp473 UTSW 7 44734594 missense probably benign 0.00
R2141:Zfp473 UTSW 7 44733077 missense possibly damaging 0.57
R2142:Zfp473 UTSW 7 44733077 missense possibly damaging 0.57
R4194:Zfp473 UTSW 7 44732252 missense probably benign 0.08
R4453:Zfp473 UTSW 7 44733254 missense probably damaging 0.99
R4585:Zfp473 UTSW 7 44732952 nonsense probably null
R4586:Zfp473 UTSW 7 44732952 nonsense probably null
R4945:Zfp473 UTSW 7 44734564 missense probably benign 0.00
R5072:Zfp473 UTSW 7 44732519 missense probably damaging 0.98
R5429:Zfp473 UTSW 7 44732848 missense possibly damaging 0.69
R5464:Zfp473 UTSW 7 44732638 missense probably damaging 1.00
R5551:Zfp473 UTSW 7 44734151 missense probably benign 0.03
R5618:Zfp473 UTSW 7 44741732 missense probably benign 0.08
R5985:Zfp473 UTSW 7 44733328 missense probably damaging 1.00
R6288:Zfp473 UTSW 7 44733534 missense probably damaging 1.00
R6701:Zfp473 UTSW 7 44732794 missense possibly damaging 0.58
X0027:Zfp473 UTSW 7 44733418 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGCTGTTTGAAGGCCCTGTTG -3'
(R):5'- GGCTGTGCTAAATGCAAGGAGACC -3'

Sequencing Primer
(F):5'- AAGGCCCTGTTGTATATGTCACAC -3'
(R):5'- GCAGGTCAACTCTGAATTGCC -3'
Posted On2014-03-17