Incidental Mutation 'R1387:Glb1'
ID162437
Institutional Source Beutler Lab
Gene Symbol Glb1
Ensembl Gene ENSMUSG00000045594
Gene Namegalactosidase, beta 1
SynonymsC130097A14Rik, Bgs, Bgl-t, Bgl, Bgl-e, Bgt, Bge, Bgl-s
MMRRC Submission 039449-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1387 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location114401076-114474898 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 114420363 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 5 (W5R)
Ref Sequence ENSEMBL: ENSMUSP00000149937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063042] [ENSMUST00000217583]
Predicted Effect probably damaging
Transcript: ENSMUST00000063042
AA Change: W87R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055803
Gene: ENSMUSG00000045594
AA Change: W87R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Glyco_hydro_35 41 358 2.5e-129 PFAM
Pfam:Glyco_hydro_42 56 216 9.4e-15 PFAM
Pfam:BetaGal_dom4_5 531 623 4.3e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217583
AA Change: W5R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.676 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.4%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: This gene encodes a preproprotein that is proteolytically cleaved to yield a signal peptide and a proproptein that is subsequently processed to generate the active mature peptide. The encoded protein is a lysosomal enzyme that catalyzes the hydrolysis of terminal beta-D-galactose residues in various substrates like lactose, ganglioside GM1 and other glycoproteins. Mutations in the human gene are associated with GM1-gangliosidosis and Morquio B syndrome. Disruption of the mouse gene mirrors the symptoms of human gangliosidosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit progressive spastic diplegia, emaciation, and accumulation of ganglioside GM1 and asialo GM1 in brain tissue. Mutants die at 7-10 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610303G11Rik T A 9: 98,186,759 noncoding transcript Het
4930447C04Rik C A 12: 72,915,434 R52L probably benign Het
9930021J03Rik A G 19: 29,723,453 I812T probably benign Het
Abca13 C T 11: 9,682,085 Q5002* probably null Het
Acacb T C 5: 114,200,512 I761T probably benign Het
Acap3 G T 4: 155,899,480 L134F probably benign Het
Adamtsl1 T C 4: 86,374,993 probably benign Het
Adgrv1 A G 13: 81,493,176 V3278A possibly damaging Het
Agxt2 T C 15: 10,380,610 Y196H probably damaging Het
Akap13 T C 7: 75,586,193 V172A probably damaging Het
Aqp8 A G 7: 123,466,668 I229V probably benign Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Cacng8 T C 7: 3,415,156 S275P possibly damaging Het
Catsperg1 T C 7: 29,206,864 Y138C probably damaging Het
Ccdc93 T G 1: 121,491,189 L491R probably damaging Het
Cntnap2 T C 6: 47,107,914 V1103A probably benign Het
Col12a1 C T 9: 79,681,375 probably benign Het
Col6a3 A G 1: 90,822,416 probably benign Het
Csf2rb2 C T 15: 78,298,214 A6T probably damaging Het
Cyp2j5 T A 4: 96,634,285 S351C probably damaging Het
Cyth1 A G 11: 118,182,346 probably benign Het
Dock2 A G 11: 34,273,309 probably benign Het
Duoxa1 T A 2: 122,303,987 I262F possibly damaging Het
Dync2h1 T C 9: 7,125,816 D1930G probably benign Het
Elmsan1 C A 12: 84,152,931 R1005L probably damaging Het
Eno1 C T 4: 150,248,133 probably benign Het
Fam102a T C 2: 32,565,623 S254P possibly damaging Het
Fam98a T A 17: 75,538,269 H494L unknown Het
Fcamr C A 1: 130,804,642 T122K possibly damaging Het
Foxq1 A G 13: 31,559,305 D130G probably damaging Het
Gm17661 GA GAA 2: 90,917,709 noncoding transcript Het
Gm5431 T A 11: 48,895,015 R178W possibly damaging Het
Gys2 C T 6: 142,461,283 V116M probably benign Het
Hif1a C T 12: 73,942,292 T651I possibly damaging Het
Itgb5 T A 16: 33,900,515 Y3* probably null Het
Kank3 A G 17: 33,816,231 N7S possibly damaging Het
Kdm2b G T 5: 122,880,268 H981Q probably damaging Het
Kdm6a C T X: 18,253,996 probably benign Het
Kif1a A T 1: 93,055,950 probably benign Het
Knl1 T A 2: 119,070,730 S971T possibly damaging Het
Lcn6 T C 2: 25,677,137 V50A possibly damaging Het
Llgl2 G T 11: 115,853,132 V762F probably damaging Het
Lpcat4 T C 2: 112,244,676 F342L probably benign Het
Lrp2 C A 2: 69,456,918 G3725V probably damaging Het
Map1b T C 13: 99,432,650 T1188A unknown Het
Mecp2 G A X: 74,035,788 P362S possibly damaging Het
Mmp13 T A 9: 7,282,033 F445Y possibly damaging Het
Myo5b G T 18: 74,644,201 probably benign Het
Myo7b A G 18: 31,983,752 probably benign Het
Nadk2 C A 15: 9,106,782 L384I possibly damaging Het
Napg A G 18: 62,986,212 I98V possibly damaging Het
Ncoa1 G T 12: 4,274,790 N1041K probably benign Het
Nmu A T 5: 76,350,145 C64* probably null Het
Nobox T A 6: 43,307,198 K13M probably damaging Het
Nos1 T C 5: 117,953,783 probably benign Het
Nrg2 A G 18: 36,196,739 V141A probably damaging Het
Olfr170 T C 16: 19,606,027 I214V probably damaging Het
Olfr362 T G 2: 37,104,868 I261L probably benign Het
Olfr544 T A 7: 102,484,704 I139L probably benign Het
Phldb2 C T 16: 45,825,994 E71K possibly damaging Het
Pik3r4 T A 9: 105,644,291 Y19N probably damaging Het
Pkhd1 A C 1: 20,555,223 probably benign Het
Pogk G T 1: 166,400,138 P148Q possibly damaging Het
Pten G T 19: 32,798,096 A79S probably benign Het
Ptpdc1 A T 13: 48,586,320 V545E possibly damaging Het
Qdpr G C 5: 45,450,138 probably benign Het
Rhbdd3 T A 11: 5,104,121 H83Q probably damaging Het
Rnf6 A G 5: 146,211,245 V321A probably benign Het
Rtf1 T A 2: 119,705,645 probably null Het
Serpina10 C T 12: 103,628,241 V240I probably benign Het
Siah2 A G 3: 58,691,514 V101A possibly damaging Het
Taok3 A G 5: 117,206,655 K46R probably damaging Het
Tcaf2 A C 6: 42,624,578 L849R probably damaging Het
Upf3a T C 8: 13,792,118 F178S probably damaging Het
Vmn1r218 G A 13: 23,137,308 G195D probably damaging Het
Vmn2r59 A G 7: 42,046,097 V297A probably damaging Het
Vmn2r70 T A 7: 85,558,761 Q836L probably benign Het
Zfp473 A G 7: 44,732,941 V655A probably benign Het
Zic5 A G 14: 122,459,485 S573P unknown Het
Other mutations in Glb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Glb1 APN 9 114450677 splice site probably benign
IGL01649:Glb1 APN 9 114423948 missense probably damaging 1.00
IGL01720:Glb1 APN 9 114420505 critical splice donor site probably null
IGL02199:Glb1 APN 9 114473947 missense probably benign 0.06
IGL02613:Glb1 APN 9 114464062 missense possibly damaging 0.91
IGL03392:Glb1 APN 9 114430321 missense probably damaging 1.00
R0463:Glb1 UTSW 9 114421744 frame shift probably null
R0518:Glb1 UTSW 9 114421744 frame shift probably null
R0519:Glb1 UTSW 9 114421744 frame shift probably null
R0520:Glb1 UTSW 9 114421744 frame shift probably null
R1499:Glb1 UTSW 9 114417103 missense probably benign 0.04
R1898:Glb1 UTSW 9 114424035 missense probably damaging 1.00
R2143:Glb1 UTSW 9 114437824 missense probably damaging 1.00
R2145:Glb1 UTSW 9 114464165 missense probably benign 0.00
R2146:Glb1 UTSW 9 114450648 missense probably damaging 1.00
R2148:Glb1 UTSW 9 114450648 missense probably damaging 1.00
R2149:Glb1 UTSW 9 114450648 missense probably damaging 1.00
R2150:Glb1 UTSW 9 114450648 missense probably damaging 1.00
R2170:Glb1 UTSW 9 114473805 critical splice acceptor site probably benign
R2259:Glb1 UTSW 9 114443032 nonsense probably null
R2401:Glb1 UTSW 9 114454257 missense possibly damaging 0.81
R3980:Glb1 UTSW 9 114417064 missense probably damaging 0.97
R4488:Glb1 UTSW 9 114443114 missense probably damaging 1.00
R4696:Glb1 UTSW 9 114464152 missense probably benign
R5349:Glb1 UTSW 9 114434461 critical splice donor site probably null
R6045:Glb1 UTSW 9 114437942 missense probably damaging 1.00
R6448:Glb1 UTSW 9 114434431 missense probably damaging 0.99
X0052:Glb1 UTSW 9 114473805 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- ATTCATGCCAGGCTCTGTGACTCC -3'
(R):5'- TGCAACTGGAAGCTCACCATGTC -3'

Sequencing Primer
(F):5'- cccatcccagtattcgcc -3'
(R):5'- ATGTCCCACTCTGCACAGATG -3'
Posted On2014-03-17