Incidental Mutation 'R1387:Gm5431'
ID162441
Institutional Source Beutler Lab
Gene Symbol Gm5431
Ensembl Gene ENSMUSG00000058163
Gene Namepredicted gene 5431
Synonyms
MMRRC Submission 039449-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.033) question?
Stock #R1387 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location48887422-48902214 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 48895015 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 178 (R178W)
Ref Sequence ENSEMBL: ENSMUSP00000104835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109209] [ENSMUST00000109210] [ENSMUST00000109212]
Predicted Effect probably benign
Transcript: ENSMUST00000109209
SMART Domains Protein: ENSMUSP00000104832
Gene: ENSMUSG00000058163

DomainStartEndE-ValueType
Pfam:IIGP 1 120 1.6e-22 PFAM
low complexity region 153 166 N/A INTRINSIC
Pfam:IIGP 169 542 9.4e-154 PFAM
Pfam:MMR_HSR1 205 359 1.5e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109210
SMART Domains Protein: ENSMUSP00000104833
Gene: ENSMUSG00000058163

DomainStartEndE-ValueType
Pfam:IIGP 1 120 1.6e-22 PFAM
low complexity region 153 166 N/A INTRINSIC
Pfam:IIGP 169 542 9.4e-154 PFAM
Pfam:MMR_HSR1 205 359 1.5e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109212
AA Change: R178W

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104835
Gene: ENSMUSG00000058163
AA Change: R178W

DomainStartEndE-ValueType
Pfam:IIGP 36 398 2.5e-125 PFAM
Pfam:DLIC 54 107 3.4e-5 PFAM
Pfam:MMR_HSR1 72 235 1.7e-11 PFAM
low complexity region 431 444 N/A INTRINSIC
Pfam:IIGP 447 820 6.3e-153 PFAM
Pfam:MMR_HSR1 483 606 2.4e-7 PFAM
Meta Mutation Damage Score 0.0536 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.4%
Validation Efficiency 99% (82/83)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610303G11Rik T A 9: 98,186,759 noncoding transcript Het
4930447C04Rik C A 12: 72,915,434 R52L probably benign Het
9930021J03Rik A G 19: 29,723,453 I812T probably benign Het
Abca13 C T 11: 9,682,085 Q5002* probably null Het
Acacb T C 5: 114,200,512 I761T probably benign Het
Acap3 G T 4: 155,899,480 L134F probably benign Het
Adamtsl1 T C 4: 86,374,993 probably benign Het
Adgrv1 A G 13: 81,493,176 V3278A possibly damaging Het
Agxt2 T C 15: 10,380,610 Y196H probably damaging Het
Akap13 T C 7: 75,586,193 V172A probably damaging Het
Aqp8 A G 7: 123,466,668 I229V probably benign Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Cacng8 T C 7: 3,415,156 S275P possibly damaging Het
Catsperg1 T C 7: 29,206,864 Y138C probably damaging Het
Ccdc93 T G 1: 121,491,189 L491R probably damaging Het
Cntnap2 T C 6: 47,107,914 V1103A probably benign Het
Col12a1 C T 9: 79,681,375 probably benign Het
Col6a3 A G 1: 90,822,416 probably benign Het
Csf2rb2 C T 15: 78,298,214 A6T probably damaging Het
Cyp2j5 T A 4: 96,634,285 S351C probably damaging Het
Cyth1 A G 11: 118,182,346 probably benign Het
Dock2 A G 11: 34,273,309 probably benign Het
Duoxa1 T A 2: 122,303,987 I262F possibly damaging Het
Dync2h1 T C 9: 7,125,816 D1930G probably benign Het
Elmsan1 C A 12: 84,152,931 R1005L probably damaging Het
Eno1 C T 4: 150,248,133 probably benign Het
Fam102a T C 2: 32,565,623 S254P possibly damaging Het
Fam98a T A 17: 75,538,269 H494L unknown Het
Fcamr C A 1: 130,804,642 T122K possibly damaging Het
Foxq1 A G 13: 31,559,305 D130G probably damaging Het
Glb1 T A 9: 114,420,363 W5R probably damaging Het
Gm17661 GA GAA 2: 90,917,709 noncoding transcript Het
Gys2 C T 6: 142,461,283 V116M probably benign Het
Hif1a C T 12: 73,942,292 T651I possibly damaging Het
Itgb5 T A 16: 33,900,515 Y3* probably null Het
Kank3 A G 17: 33,816,231 N7S possibly damaging Het
Kdm2b G T 5: 122,880,268 H981Q probably damaging Het
Kdm6a C T X: 18,253,996 probably benign Het
Kif1a A T 1: 93,055,950 probably benign Het
Knl1 T A 2: 119,070,730 S971T possibly damaging Het
Lcn6 T C 2: 25,677,137 V50A possibly damaging Het
Llgl2 G T 11: 115,853,132 V762F probably damaging Het
Lpcat4 T C 2: 112,244,676 F342L probably benign Het
Lrp2 C A 2: 69,456,918 G3725V probably damaging Het
Map1b T C 13: 99,432,650 T1188A unknown Het
Mecp2 G A X: 74,035,788 P362S possibly damaging Het
Mmp13 T A 9: 7,282,033 F445Y possibly damaging Het
Myo5b G T 18: 74,644,201 probably benign Het
Myo7b A G 18: 31,983,752 probably benign Het
Nadk2 C A 15: 9,106,782 L384I possibly damaging Het
Napg A G 18: 62,986,212 I98V possibly damaging Het
Ncoa1 G T 12: 4,274,790 N1041K probably benign Het
Nmu A T 5: 76,350,145 C64* probably null Het
Nobox T A 6: 43,307,198 K13M probably damaging Het
Nos1 T C 5: 117,953,783 probably benign Het
Nrg2 A G 18: 36,196,739 V141A probably damaging Het
Olfr170 T C 16: 19,606,027 I214V probably damaging Het
Olfr362 T G 2: 37,104,868 I261L probably benign Het
Olfr544 T A 7: 102,484,704 I139L probably benign Het
Phldb2 C T 16: 45,825,994 E71K possibly damaging Het
Pik3r4 T A 9: 105,644,291 Y19N probably damaging Het
Pkhd1 A C 1: 20,555,223 probably benign Het
Pogk G T 1: 166,400,138 P148Q possibly damaging Het
Pten G T 19: 32,798,096 A79S probably benign Het
Ptpdc1 A T 13: 48,586,320 V545E possibly damaging Het
Qdpr G C 5: 45,450,138 probably benign Het
Rhbdd3 T A 11: 5,104,121 H83Q probably damaging Het
Rnf6 A G 5: 146,211,245 V321A probably benign Het
Rtf1 T A 2: 119,705,645 probably null Het
Serpina10 C T 12: 103,628,241 V240I probably benign Het
Siah2 A G 3: 58,691,514 V101A possibly damaging Het
Taok3 A G 5: 117,206,655 K46R probably damaging Het
Tcaf2 A C 6: 42,624,578 L849R probably damaging Het
Upf3a T C 8: 13,792,118 F178S probably damaging Het
Vmn1r218 G A 13: 23,137,308 G195D probably damaging Het
Vmn2r59 A G 7: 42,046,097 V297A probably damaging Het
Vmn2r70 T A 7: 85,558,761 Q836L probably benign Het
Zfp473 A G 7: 44,732,941 V655A probably benign Het
Zic5 A G 14: 122,459,485 S573P unknown Het
Other mutations in Gm5431
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Gm5431 APN 11 48895414 missense probably benign 0.09
IGL00964:Gm5431 APN 11 48889267 missense probably damaging 0.99
IGL01571:Gm5431 APN 11 48894713 missense probably benign 0.00
IGL02006:Gm5431 APN 11 48888503 missense probably damaging 1.00
IGL02084:Gm5431 APN 11 48889085 missense probably benign 0.41
IGL02255:Gm5431 APN 11 48888958 missense possibly damaging 0.93
IGL02291:Gm5431 APN 11 48888964 missense probably damaging 1.00
IGL03194:Gm5431 APN 11 48895537 intron probably benign
IGL03251:Gm5431 APN 11 48894721 missense probably benign 0.00
R1168:Gm5431 UTSW 11 48895364 missense probably benign 0.36
R1396:Gm5431 UTSW 11 48895434 intron probably benign
R1711:Gm5431 UTSW 11 48895026 missense possibly damaging 0.73
R1750:Gm5431 UTSW 11 48894831 missense probably benign 0.01
R1927:Gm5431 UTSW 11 48889255 missense probably damaging 1.00
R1957:Gm5431 UTSW 11 48888397 nonsense probably null
R2196:Gm5431 UTSW 11 48889231 missense probably damaging 1.00
R2509:Gm5431 UTSW 11 48888709 missense probably benign 0.16
R2511:Gm5431 UTSW 11 48888709 missense probably benign 0.16
R4018:Gm5431 UTSW 11 48889168 missense probably damaging 1.00
R4859:Gm5431 UTSW 11 48889582 missense probably damaging 1.00
R4895:Gm5431 UTSW 11 48889028 missense probably damaging 0.98
R5124:Gm5431 UTSW 11 48889039 missense probably benign 0.31
R5311:Gm5431 UTSW 11 48888889 missense probably damaging 1.00
R5600:Gm5431 UTSW 11 48894756 missense possibly damaging 0.56
R5728:Gm5431 UTSW 11 48888613 missense probably damaging 1.00
R5731:Gm5431 UTSW 11 48894448 missense probably damaging 0.96
R6120:Gm5431 UTSW 11 48894781 missense probably benign 0.36
R6129:Gm5431 UTSW 11 48889591 missense probably damaging 1.00
R6169:Gm5431 UTSW 11 48888575 missense probably benign 0.29
R6192:Gm5431 UTSW 11 48894393 missense probably benign 0.01
R6253:Gm5431 UTSW 11 48894999 missense probably benign 0.00
R6326:Gm5431 UTSW 11 48889345 missense probably damaging 1.00
R6401:Gm5431 UTSW 11 48888709 missense probably benign 0.16
R6654:Gm5431 UTSW 11 48894600 missense possibly damaging 0.91
R6810:Gm5431 UTSW 11 48888976 missense probably damaging 1.00
R6965:Gm5431 UTSW 11 48895200 missense probably benign 0.19
R6970:Gm5431 UTSW 11 48888490 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACGTGAGCATGAACATGTGGTG -3'
(R):5'- TCCCTAGAGGATGGAAACCTTCGG -3'

Sequencing Primer
(F):5'- GCTCAGAAGGGTGGATTCC -3'
(R):5'- CAGTTTCTGCAATCAGCAGTG -3'
Posted On2014-03-17