Incidental Mutation 'R1387:Llgl2'
ID162442
Institutional Source Beutler Lab
Gene Symbol Llgl2
Ensembl Gene ENSMUSG00000020782
Gene NameLLGL2 scribble cell polarity complex component
Synonyms9130006H11Rik
MMRRC Submission 039449-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.525) question?
Stock #R1387 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location115824049-115855780 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 115853132 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 762 (V762F)
Ref Sequence ENSEMBL: ENSMUSP00000099321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103032] [ENSMUST00000177736]
Predicted Effect probably damaging
Transcript: ENSMUST00000103032
AA Change: V762F

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099321
Gene: ENSMUSG00000020782
AA Change: V762F

DomainStartEndE-ValueType
WD40 24 60 9.17e1 SMART
WD40 62 101 7.96e0 SMART
Blast:WD40 112 157 6e-20 BLAST
WD40 181 217 3.96e1 SMART
WD40 221 258 5.7e1 SMART
Pfam:LLGL 268 372 3.2e-47 PFAM
WD40 411 451 1.38e0 SMART
Blast:WD40 489 532 3e-12 BLAST
low complexity region 536 547 N/A INTRINSIC
Blast:WD40 576 615 2e-10 BLAST
low complexity region 649 668 N/A INTRINSIC
Blast:WD40 830 879 2e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000128826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132999
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147878
Predicted Effect possibly damaging
Transcript: ENSMUST00000177736
AA Change: V786F

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000136054
Gene: ENSMUSG00000020782
AA Change: V786F

DomainStartEndE-ValueType
WD40 24 60 5.9e-1 SMART
WD40 62 101 5.2e-2 SMART
Blast:WD40 112 157 6e-20 BLAST
WD40 181 217 2.5e-1 SMART
WD40 221 258 3.6e-1 SMART
Pfam:LLGL 271 372 6.2e-41 PFAM
WD40 411 451 8.8e-3 SMART
Blast:WD40 489 532 3e-12 BLAST
low complexity region 536 547 N/A INTRINSIC
Blast:WD40 576 615 2e-10 BLAST
low complexity region 649 668 N/A INTRINSIC
Blast:WD40 854 903 2e-10 BLAST
Meta Mutation Damage Score 0.0348 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.4%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The lethal (2) giant larvae protein of Drosophila plays a role in asymmetric cell division, epithelial cell polarity, and cell migration. This human gene encodes a protein similar to lethal (2) giant larvae of Drosophila. In fly, the protein's ability to localize cell fate determinants is regulated by the atypical protein kinase C (aPKC). In human, this protein interacts with aPKC-containing complexes and is cortically localized in mitotic cells. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele exhibit abnormal branching morphogenesis of the placental labyrinth layer and are born as runts but catch up in size by adulthood. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610303G11Rik T A 9: 98,186,759 noncoding transcript Het
4930447C04Rik C A 12: 72,915,434 R52L probably benign Het
9930021J03Rik A G 19: 29,723,453 I812T probably benign Het
Abca13 C T 11: 9,682,085 Q5002* probably null Het
Acacb T C 5: 114,200,512 I761T probably benign Het
Acap3 G T 4: 155,899,480 L134F probably benign Het
Adamtsl1 T C 4: 86,374,993 probably benign Het
Adgrv1 A G 13: 81,493,176 V3278A possibly damaging Het
Agxt2 T C 15: 10,380,610 Y196H probably damaging Het
Akap13 T C 7: 75,586,193 V172A probably damaging Het
Aqp8 A G 7: 123,466,668 I229V probably benign Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Cacng8 T C 7: 3,415,156 S275P possibly damaging Het
Catsperg1 T C 7: 29,206,864 Y138C probably damaging Het
Ccdc93 T G 1: 121,491,189 L491R probably damaging Het
Cntnap2 T C 6: 47,107,914 V1103A probably benign Het
Col12a1 C T 9: 79,681,375 probably benign Het
Col6a3 A G 1: 90,822,416 probably benign Het
Csf2rb2 C T 15: 78,298,214 A6T probably damaging Het
Cyp2j5 T A 4: 96,634,285 S351C probably damaging Het
Cyth1 A G 11: 118,182,346 probably benign Het
Dock2 A G 11: 34,273,309 probably benign Het
Duoxa1 T A 2: 122,303,987 I262F possibly damaging Het
Dync2h1 T C 9: 7,125,816 D1930G probably benign Het
Elmsan1 C A 12: 84,152,931 R1005L probably damaging Het
Eno1 C T 4: 150,248,133 probably benign Het
Fam102a T C 2: 32,565,623 S254P possibly damaging Het
Fam98a T A 17: 75,538,269 H494L unknown Het
Fcamr C A 1: 130,804,642 T122K possibly damaging Het
Foxq1 A G 13: 31,559,305 D130G probably damaging Het
Glb1 T A 9: 114,420,363 W5R probably damaging Het
Gm17661 GA GAA 2: 90,917,709 noncoding transcript Het
Gm5431 T A 11: 48,895,015 R178W possibly damaging Het
Gys2 C T 6: 142,461,283 V116M probably benign Het
Hif1a C T 12: 73,942,292 T651I possibly damaging Het
Itgb5 T A 16: 33,900,515 Y3* probably null Het
Kank3 A G 17: 33,816,231 N7S possibly damaging Het
Kdm2b G T 5: 122,880,268 H981Q probably damaging Het
Kdm6a C T X: 18,253,996 probably benign Het
Kif1a A T 1: 93,055,950 probably benign Het
Knl1 T A 2: 119,070,730 S971T possibly damaging Het
Lcn6 T C 2: 25,677,137 V50A possibly damaging Het
Lpcat4 T C 2: 112,244,676 F342L probably benign Het
Lrp2 C A 2: 69,456,918 G3725V probably damaging Het
Map1b T C 13: 99,432,650 T1188A unknown Het
Mecp2 G A X: 74,035,788 P362S possibly damaging Het
Mmp13 T A 9: 7,282,033 F445Y possibly damaging Het
Myo5b G T 18: 74,644,201 probably benign Het
Myo7b A G 18: 31,983,752 probably benign Het
Nadk2 C A 15: 9,106,782 L384I possibly damaging Het
Napg A G 18: 62,986,212 I98V possibly damaging Het
Ncoa1 G T 12: 4,274,790 N1041K probably benign Het
Nmu A T 5: 76,350,145 C64* probably null Het
Nobox T A 6: 43,307,198 K13M probably damaging Het
Nos1 T C 5: 117,953,783 probably benign Het
Nrg2 A G 18: 36,196,739 V141A probably damaging Het
Olfr170 T C 16: 19,606,027 I214V probably damaging Het
Olfr362 T G 2: 37,104,868 I261L probably benign Het
Olfr544 T A 7: 102,484,704 I139L probably benign Het
Phldb2 C T 16: 45,825,994 E71K possibly damaging Het
Pik3r4 T A 9: 105,644,291 Y19N probably damaging Het
Pkhd1 A C 1: 20,555,223 probably benign Het
Pogk G T 1: 166,400,138 P148Q possibly damaging Het
Pten G T 19: 32,798,096 A79S probably benign Het
Ptpdc1 A T 13: 48,586,320 V545E possibly damaging Het
Qdpr G C 5: 45,450,138 probably benign Het
Rhbdd3 T A 11: 5,104,121 H83Q probably damaging Het
Rnf6 A G 5: 146,211,245 V321A probably benign Het
Rtf1 T A 2: 119,705,645 probably null Het
Serpina10 C T 12: 103,628,241 V240I probably benign Het
Siah2 A G 3: 58,691,514 V101A possibly damaging Het
Taok3 A G 5: 117,206,655 K46R probably damaging Het
Tcaf2 A C 6: 42,624,578 L849R probably damaging Het
Upf3a T C 8: 13,792,118 F178S probably damaging Het
Vmn1r218 G A 13: 23,137,308 G195D probably damaging Het
Vmn2r59 A G 7: 42,046,097 V297A probably damaging Het
Vmn2r70 T A 7: 85,558,761 Q836L probably benign Het
Zfp473 A G 7: 44,732,941 V655A probably benign Het
Zic5 A G 14: 122,459,485 S573P unknown Het
Other mutations in Llgl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Llgl2 APN 11 115834884 missense probably benign 0.00
IGL01145:Llgl2 APN 11 115853805 missense probably benign
IGL01344:Llgl2 APN 11 115851193 missense probably benign 0.01
IGL01980:Llgl2 APN 11 115850025 missense probably damaging 1.00
IGL02220:Llgl2 APN 11 115845379 missense possibly damaging 0.64
IGL02341:Llgl2 APN 11 115851120 missense possibly damaging 0.70
IGL02399:Llgl2 APN 11 115844835 missense probably damaging 0.97
IGL02415:Llgl2 APN 11 115853285 missense probably damaging 0.98
IGL02632:Llgl2 APN 11 115844872 missense probably damaging 1.00
IGL02990:Llgl2 APN 11 115854333 missense probably benign 0.01
IGL03405:Llgl2 APN 11 115850842 missense probably benign 0.09
R0097:Llgl2 UTSW 11 115844497 nonsense probably null
R0166:Llgl2 UTSW 11 115844854 missense probably damaging 1.00
R0277:Llgl2 UTSW 11 115850720 missense probably damaging 1.00
R0323:Llgl2 UTSW 11 115850720 missense probably damaging 1.00
R0345:Llgl2 UTSW 11 115849992 splice site probably benign
R0614:Llgl2 UTSW 11 115850267 missense probably damaging 1.00
R0980:Llgl2 UTSW 11 115850001 missense probably damaging 1.00
R1456:Llgl2 UTSW 11 115845499 missense probably benign 0.00
R1541:Llgl2 UTSW 11 115853121 missense probably benign 0.00
R1832:Llgl2 UTSW 11 115851100 missense probably damaging 1.00
R1950:Llgl2 UTSW 11 115851066 missense probably damaging 0.96
R2991:Llgl2 UTSW 11 115851120 missense probably benign 0.05
R4018:Llgl2 UTSW 11 115847612 missense probably benign 0.31
R4582:Llgl2 UTSW 11 115850706 missense possibly damaging 0.89
R4729:Llgl2 UTSW 11 115848299 missense probably damaging 0.98
R4907:Llgl2 UTSW 11 115853974 nonsense probably null
R5000:Llgl2 UTSW 11 115844902 missense probably benign
R5016:Llgl2 UTSW 11 115853424 missense probably damaging 1.00
R5175:Llgl2 UTSW 11 115850721 missense probably damaging 1.00
R5857:Llgl2 UTSW 11 115850281 missense probably damaging 1.00
R6190:Llgl2 UTSW 11 115846986 missense probably benign 0.00
R6451:Llgl2 UTSW 11 115844941 missense probably damaging 0.99
R6804:Llgl2 UTSW 11 115843315 critical splice acceptor site probably null
R6909:Llgl2 UTSW 11 115850799 missense probably damaging 1.00
X0058:Llgl2 UTSW 11 115850637 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTCTGCTGTGTCCCTGCAAAG -3'
(R):5'- AGCTGGATCTCCTTGGCTACAGAG -3'

Sequencing Primer
(F):5'- taggaggcagtggcagg -3'
(R):5'- CTTGGCTACAGAGGAGGGC -3'
Posted On2014-03-17