Incidental Mutation 'R1387:Cyth1'
ID162443
Institutional Source Beutler Lab
Gene Symbol Cyth1
Ensembl Gene ENSMUSG00000017132
Gene Namecytohesin 1
SynonymsCTH-1, Pscd1, CLM1
MMRRC Submission 039449-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R1387 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location118132019-118248592 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 118182346 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017276] [ENSMUST00000100181] [ENSMUST00000106302] [ENSMUST00000106305] [ENSMUST00000151165]
Predicted Effect probably benign
Transcript: ENSMUST00000017276
SMART Domains Protein: ENSMUSP00000017276
Gene: ENSMUSG00000017132

DomainStartEndE-ValueType
Sec7 59 244 1.38e-108 SMART
PH 261 378 4.8e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100181
SMART Domains Protein: ENSMUSP00000097756
Gene: ENSMUSG00000017132

DomainStartEndE-ValueType
Sec7 73 258 1.38e-108 SMART
PH 275 392 1.65e-23 SMART
low complexity region 402 425 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106302
SMART Domains Protein: ENSMUSP00000101909
Gene: ENSMUSG00000017132

DomainStartEndE-ValueType
Sec7 61 246 1.38e-108 SMART
PH 263 381 4.18e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106305
SMART Domains Protein: ENSMUSP00000101912
Gene: ENSMUSG00000017132

DomainStartEndE-ValueType
Sec7 59 244 1.38e-108 SMART
PH 261 379 4.18e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141243
Predicted Effect probably benign
Transcript: ENSMUST00000151165
SMART Domains Protein: ENSMUSP00000114792
Gene: ENSMUSG00000017132

DomainStartEndE-ValueType
SCOP:d1pbv__ 55 99 4e-15 SMART
PDB:1BC9|A 60 99 9e-21 PDB
Blast:Sec7 61 99 1e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157494
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.4%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the PSCD family. Members of this family have identical structural organization that consists of an N-terminal coiled-coil motif, a central Sec7 domain, and a C-terminal pleckstrin homology (PH) domain. The coiled-coil motif is involved in homodimerization, the Sec7 domain contains guanine-nucleotide exchange protein activity, and the PH domain interacts with phospholipids and is responsible for association of PSCDs with membranes. Members of this family appear to mediate the regulation of protein sorting and membrane trafficking. This gene is highly expressed in natural killer and peripheral T cells, and regulates the adhesiveness of integrins at the plasma membrane of lymphocytes. A pseudogene of this gene has been defined on the X chromosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit normal brain morphology and long term potentiation. Mice homozygous for a knock-out allele exhibit decreased myelin sheath thickness due to hypomyelination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610303G11Rik T A 9: 98,186,759 noncoding transcript Het
4930447C04Rik C A 12: 72,915,434 R52L probably benign Het
9930021J03Rik A G 19: 29,723,453 I812T probably benign Het
Abca13 C T 11: 9,682,085 Q5002* probably null Het
Acacb T C 5: 114,200,512 I761T probably benign Het
Acap3 G T 4: 155,899,480 L134F probably benign Het
Adamtsl1 T C 4: 86,374,993 probably benign Het
Adgrv1 A G 13: 81,493,176 V3278A possibly damaging Het
Agxt2 T C 15: 10,380,610 Y196H probably damaging Het
Akap13 T C 7: 75,586,193 V172A probably damaging Het
Aqp8 A G 7: 123,466,668 I229V probably benign Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Cacng8 T C 7: 3,415,156 S275P possibly damaging Het
Catsperg1 T C 7: 29,206,864 Y138C probably damaging Het
Ccdc93 T G 1: 121,491,189 L491R probably damaging Het
Cntnap2 T C 6: 47,107,914 V1103A probably benign Het
Col12a1 C T 9: 79,681,375 probably benign Het
Col6a3 A G 1: 90,822,416 probably benign Het
Csf2rb2 C T 15: 78,298,214 A6T probably damaging Het
Cyp2j5 T A 4: 96,634,285 S351C probably damaging Het
Dock2 A G 11: 34,273,309 probably benign Het
Duoxa1 T A 2: 122,303,987 I262F possibly damaging Het
Dync2h1 T C 9: 7,125,816 D1930G probably benign Het
Elmsan1 C A 12: 84,152,931 R1005L probably damaging Het
Eno1 C T 4: 150,248,133 probably benign Het
Fam102a T C 2: 32,565,623 S254P possibly damaging Het
Fam98a T A 17: 75,538,269 H494L unknown Het
Fcamr C A 1: 130,804,642 T122K possibly damaging Het
Foxq1 A G 13: 31,559,305 D130G probably damaging Het
Glb1 T A 9: 114,420,363 W5R probably damaging Het
Gm17661 GA GAA 2: 90,917,709 noncoding transcript Het
Gm5431 T A 11: 48,895,015 R178W possibly damaging Het
Gys2 C T 6: 142,461,283 V116M probably benign Het
Hif1a C T 12: 73,942,292 T651I possibly damaging Het
Itgb5 T A 16: 33,900,515 Y3* probably null Het
Kank3 A G 17: 33,816,231 N7S possibly damaging Het
Kdm2b G T 5: 122,880,268 H981Q probably damaging Het
Kdm6a C T X: 18,253,996 probably benign Het
Kif1a A T 1: 93,055,950 probably benign Het
Knl1 T A 2: 119,070,730 S971T possibly damaging Het
Lcn6 T C 2: 25,677,137 V50A possibly damaging Het
Llgl2 G T 11: 115,853,132 V762F probably damaging Het
Lpcat4 T C 2: 112,244,676 F342L probably benign Het
Lrp2 C A 2: 69,456,918 G3725V probably damaging Het
Map1b T C 13: 99,432,650 T1188A unknown Het
Mecp2 G A X: 74,035,788 P362S possibly damaging Het
Mmp13 T A 9: 7,282,033 F445Y possibly damaging Het
Myo5b G T 18: 74,644,201 probably benign Het
Myo7b A G 18: 31,983,752 probably benign Het
Nadk2 C A 15: 9,106,782 L384I possibly damaging Het
Napg A G 18: 62,986,212 I98V possibly damaging Het
Ncoa1 G T 12: 4,274,790 N1041K probably benign Het
Nmu A T 5: 76,350,145 C64* probably null Het
Nobox T A 6: 43,307,198 K13M probably damaging Het
Nos1 T C 5: 117,953,783 probably benign Het
Nrg2 A G 18: 36,196,739 V141A probably damaging Het
Olfr170 T C 16: 19,606,027 I214V probably damaging Het
Olfr362 T G 2: 37,104,868 I261L probably benign Het
Olfr544 T A 7: 102,484,704 I139L probably benign Het
Phldb2 C T 16: 45,825,994 E71K possibly damaging Het
Pik3r4 T A 9: 105,644,291 Y19N probably damaging Het
Pkhd1 A C 1: 20,555,223 probably benign Het
Pogk G T 1: 166,400,138 P148Q possibly damaging Het
Pten G T 19: 32,798,096 A79S probably benign Het
Ptpdc1 A T 13: 48,586,320 V545E possibly damaging Het
Qdpr G C 5: 45,450,138 probably benign Het
Rhbdd3 T A 11: 5,104,121 H83Q probably damaging Het
Rnf6 A G 5: 146,211,245 V321A probably benign Het
Rtf1 T A 2: 119,705,645 probably null Het
Serpina10 C T 12: 103,628,241 V240I probably benign Het
Siah2 A G 3: 58,691,514 V101A possibly damaging Het
Taok3 A G 5: 117,206,655 K46R probably damaging Het
Tcaf2 A C 6: 42,624,578 L849R probably damaging Het
Upf3a T C 8: 13,792,118 F178S probably damaging Het
Vmn1r218 G A 13: 23,137,308 G195D probably damaging Het
Vmn2r59 A G 7: 42,046,097 V297A probably damaging Het
Vmn2r70 T A 7: 85,558,761 Q836L probably benign Het
Zfp473 A G 7: 44,732,941 V655A probably benign Het
Zic5 A G 14: 122,459,485 S573P unknown Het
Other mutations in Cyth1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Cyth1 APN 11 118193613 critical splice donor site probably null
IGL02047:Cyth1 APN 11 118169132 missense probably damaging 1.00
IGL02658:Cyth1 APN 11 118182246 missense probably damaging 0.99
IGL02826:Cyth1 APN 11 118185481 missense possibly damaging 0.89
Mucilage UTSW 11 118170860 missense probably damaging 1.00
Stuck UTSW 11 118185759 critical splice donor site probably null
R0109:Cyth1 UTSW 11 118182306 missense probably damaging 0.98
R0109:Cyth1 UTSW 11 118182306 missense probably damaging 0.98
R0470:Cyth1 UTSW 11 118132248 unclassified probably benign
R1599:Cyth1 UTSW 11 118177221 missense probably damaging 0.99
R2098:Cyth1 UTSW 11 118193653 missense probably damaging 1.00
R2156:Cyth1 UTSW 11 118182808 missense probably damaging 1.00
R3546:Cyth1 UTSW 11 118192436 missense probably damaging 0.96
R4300:Cyth1 UTSW 11 118183894 missense probably damaging 0.98
R4589:Cyth1 UTSW 11 118184985 missense possibly damaging 0.70
R4799:Cyth1 UTSW 11 118183942 missense probably damaging 1.00
R5165:Cyth1 UTSW 11 118169082 missense possibly damaging 0.82
R5524:Cyth1 UTSW 11 118182767 missense probably benign 0.27
R5834:Cyth1 UTSW 11 118192463 critical splice acceptor site probably null
R5933:Cyth1 UTSW 11 118185759 critical splice donor site probably null
R5960:Cyth1 UTSW 11 118132367 unclassified probably benign
R6609:Cyth1 UTSW 11 118170860 missense probably damaging 1.00
R7014:Cyth1 UTSW 11 118212651 missense probably benign
R7108:Cyth1 UTSW 11 118182913 missense not run
X0063:Cyth1 UTSW 11 118132329 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ACTGCTTGTCAACAGCTCCAGAATG -3'
(R):5'- ACAGAAGGATAACTTGCTGAGTGCC -3'

Sequencing Primer
(F):5'- TGTCAACAGCTCCAGAATGGTATG -3'
(R):5'- TTAAAGGCTCAAGTAGGCTCC -3'
Posted On2014-03-17