Incidental Mutation 'R1387:Atp8a2'
ID162454
Institutional Source Beutler Lab
Gene Symbol Atp8a2
Ensembl Gene ENSMUSG00000021983
Gene NameATPase, aminophospholipid transporter-like, class I, type 8A, member 2
Synonymswl, Ib
MMRRC Submission 039449-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.715) question?
Stock #R1387 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location59638540-60197179 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59860270 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 770 (K770E)
Ref Sequence ENSEMBL: ENSMUSP00000079238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080368]
Predicted Effect probably benign
Transcript: ENSMUST00000080368
AA Change: K770E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000079238
Gene: ENSMUSG00000021983
AA Change: K770E

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 14 80 2.3e-27 PFAM
Pfam:E1-E2_ATPase 85 348 6.7e-15 PFAM
Pfam:HAD 385 790 3.2e-22 PFAM
Pfam:Cation_ATPase 465 564 3.2e-14 PFAM
Pfam:PhoLip_ATPase_C 807 1059 2.8e-79 PFAM
Meta Mutation Damage Score 0.134 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.4%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the P4 ATPase family of proteins, which are thought to be involved in a process called lipid flipping, whereby phospholipids are translocated inwards from the exoplasmic leaflet to the cytosolic leaflet of the cell membrane, which aids in generating and maintaining asymmetry in membrane lipids. This protein is predicted to contain an E1 E2 ATPase, a haloacid dehalogenase-like hydrolase (HAD) domain, and multiple transmembrane domains. Associations between this protein and cell cycle control protein 50A are important for translocation of phosphatidylserine across membranes. Mutations in this gene have been associated with cerebellar ataxia, mental retardation and disequilibrium syndrome (CAMRQ). In addition, a translocation breakpoint within this gene was observed in an individual with neurological dysfunction. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygotes for spontaneous mutations have abnormal gait and tremors, with axonal degeneration in central and peripheral neurons. Symptoms progress to immobility and death by 1-month of age. Heterozygotes show subtle locomotor abnormalities and are hyporesponsive to tail pinching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610303G11Rik T A 9: 98,186,759 noncoding transcript Het
4930447C04Rik C A 12: 72,915,434 R52L probably benign Het
9930021J03Rik A G 19: 29,723,453 I812T probably benign Het
Abca13 C T 11: 9,682,085 Q5002* probably null Het
Acacb T C 5: 114,200,512 I761T probably benign Het
Acap3 G T 4: 155,899,480 L134F probably benign Het
Adamtsl1 T C 4: 86,374,993 probably benign Het
Adgrv1 A G 13: 81,493,176 V3278A possibly damaging Het
Agxt2 T C 15: 10,380,610 Y196H probably damaging Het
Akap13 T C 7: 75,586,193 V172A probably damaging Het
Aqp8 A G 7: 123,466,668 I229V probably benign Het
Cacng8 T C 7: 3,415,156 S275P possibly damaging Het
Catsperg1 T C 7: 29,206,864 Y138C probably damaging Het
Ccdc93 T G 1: 121,491,189 L491R probably damaging Het
Cntnap2 T C 6: 47,107,914 V1103A probably benign Het
Col12a1 C T 9: 79,681,375 probably benign Het
Col6a3 A G 1: 90,822,416 probably benign Het
Csf2rb2 C T 15: 78,298,214 A6T probably damaging Het
Cyp2j5 T A 4: 96,634,285 S351C probably damaging Het
Cyth1 A G 11: 118,182,346 probably benign Het
Dock2 A G 11: 34,273,309 probably benign Het
Duoxa1 T A 2: 122,303,987 I262F possibly damaging Het
Dync2h1 T C 9: 7,125,816 D1930G probably benign Het
Elmsan1 C A 12: 84,152,931 R1005L probably damaging Het
Eno1 C T 4: 150,248,133 probably benign Het
Fam102a T C 2: 32,565,623 S254P possibly damaging Het
Fam98a T A 17: 75,538,269 H494L unknown Het
Fcamr C A 1: 130,804,642 T122K possibly damaging Het
Foxq1 A G 13: 31,559,305 D130G probably damaging Het
Glb1 T A 9: 114,420,363 W5R probably damaging Het
Gm17661 GA GAA 2: 90,917,709 noncoding transcript Het
Gm5431 T A 11: 48,895,015 R178W possibly damaging Het
Gys2 C T 6: 142,461,283 V116M probably benign Het
Hif1a C T 12: 73,942,292 T651I possibly damaging Het
Itgb5 T A 16: 33,900,515 Y3* probably null Het
Kank3 A G 17: 33,816,231 N7S possibly damaging Het
Kdm2b G T 5: 122,880,268 H981Q probably damaging Het
Kdm6a C T X: 18,253,996 probably benign Het
Kif1a A T 1: 93,055,950 probably benign Het
Knl1 T A 2: 119,070,730 S971T possibly damaging Het
Lcn6 T C 2: 25,677,137 V50A possibly damaging Het
Llgl2 G T 11: 115,853,132 V762F probably damaging Het
Lpcat4 T C 2: 112,244,676 F342L probably benign Het
Lrp2 C A 2: 69,456,918 G3725V probably damaging Het
Map1b T C 13: 99,432,650 T1188A unknown Het
Mecp2 G A X: 74,035,788 P362S possibly damaging Het
Mmp13 T A 9: 7,282,033 F445Y possibly damaging Het
Myo5b G T 18: 74,644,201 probably benign Het
Myo7b A G 18: 31,983,752 probably benign Het
Nadk2 C A 15: 9,106,782 L384I possibly damaging Het
Napg A G 18: 62,986,212 I98V possibly damaging Het
Ncoa1 G T 12: 4,274,790 N1041K probably benign Het
Nmu A T 5: 76,350,145 C64* probably null Het
Nobox T A 6: 43,307,198 K13M probably damaging Het
Nos1 T C 5: 117,953,783 probably benign Het
Nrg2 A G 18: 36,196,739 V141A probably damaging Het
Olfr170 T C 16: 19,606,027 I214V probably damaging Het
Olfr362 T G 2: 37,104,868 I261L probably benign Het
Olfr544 T A 7: 102,484,704 I139L probably benign Het
Phldb2 C T 16: 45,825,994 E71K possibly damaging Het
Pik3r4 T A 9: 105,644,291 Y19N probably damaging Het
Pkhd1 A C 1: 20,555,223 probably benign Het
Pogk G T 1: 166,400,138 P148Q possibly damaging Het
Pten G T 19: 32,798,096 A79S probably benign Het
Ptpdc1 A T 13: 48,586,320 V545E possibly damaging Het
Qdpr G C 5: 45,450,138 probably benign Het
Rhbdd3 T A 11: 5,104,121 H83Q probably damaging Het
Rnf6 A G 5: 146,211,245 V321A probably benign Het
Rtf1 T A 2: 119,705,645 probably null Het
Serpina10 C T 12: 103,628,241 V240I probably benign Het
Siah2 A G 3: 58,691,514 V101A possibly damaging Het
Taok3 A G 5: 117,206,655 K46R probably damaging Het
Tcaf2 A C 6: 42,624,578 L849R probably damaging Het
Upf3a T C 8: 13,792,118 F178S probably damaging Het
Vmn1r218 G A 13: 23,137,308 G195D probably damaging Het
Vmn2r59 A G 7: 42,046,097 V297A probably damaging Het
Vmn2r70 T A 7: 85,558,761 Q836L probably benign Het
Zfp473 A G 7: 44,732,941 V655A probably benign Het
Zic5 A G 14: 122,459,485 S573P unknown Het
Other mutations in Atp8a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01289:Atp8a2 APN 14 59691461 missense probably benign 0.00
IGL01505:Atp8a2 APN 14 60028063 missense probably benign 0.00
IGL01614:Atp8a2 APN 14 60044988 missense probably damaging 0.99
IGL01621:Atp8a2 APN 14 60015868 splice site probably benign
IGL01634:Atp8a2 APN 14 59998062 missense probably benign 0.01
IGL01672:Atp8a2 APN 14 59691533 missense probably benign 0.01
IGL01898:Atp8a2 APN 14 60023513 missense probably damaging 1.00
IGL01945:Atp8a2 APN 14 60026160 missense probably damaging 1.00
IGL02006:Atp8a2 APN 14 59857048 missense possibly damaging 0.90
IGL02089:Atp8a2 APN 14 60026920 splice site probably null
IGL02211:Atp8a2 APN 14 60027976 missense probably benign 0.00
IGL02283:Atp8a2 APN 14 60016799 missense possibly damaging 0.86
IGL02337:Atp8a2 APN 14 59998002 missense probably benign 0.32
IGL02571:Atp8a2 APN 14 60012458 splice site probably benign
IGL02795:Atp8a2 APN 14 60033742 missense probably damaging 0.96
IGL02874:Atp8a2 APN 14 59802252 missense probably damaging 1.00
IGL02999:Atp8a2 APN 14 59925122 nonsense probably null
IGL03307:Atp8a2 APN 14 60015872 critical splice donor site probably null
IGL03345:Atp8a2 APN 14 59774011 missense probably benign
R0334:Atp8a2 UTSW 14 59691512 missense probably damaging 1.00
R0368:Atp8a2 UTSW 14 59860212 missense probably damaging 1.00
R0420:Atp8a2 UTSW 14 59773744 missense probably damaging 1.00
R0684:Atp8a2 UTSW 14 60023144 missense probably benign 0.00
R0755:Atp8a2 UTSW 14 60009881 missense possibly damaging 0.96
R0853:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R0908:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R0991:Atp8a2 UTSW 14 59793929 missense probably benign 0.33
R1025:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1190:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1426:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1442:Atp8a2 UTSW 14 59860323 splice site probably benign
R1472:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1538:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1573:Atp8a2 UTSW 14 59860206 missense probably benign 0.00
R1620:Atp8a2 UTSW 14 59791183 missense probably benign
R1661:Atp8a2 UTSW 14 59860186 missense possibly damaging 0.80
R1673:Atp8a2 UTSW 14 59791240 missense probably benign 0.00
R1749:Atp8a2 UTSW 14 59860174 nonsense probably null
R1796:Atp8a2 UTSW 14 60020758 critical splice donor site probably null
R1815:Atp8a2 UTSW 14 60086624 missense probably damaging 1.00
R1836:Atp8a2 UTSW 14 60006366 missense possibly damaging 0.49
R1935:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1936:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1937:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R2416:Atp8a2 UTSW 14 59925008 missense probably damaging 1.00
R2760:Atp8a2 UTSW 14 59860192 missense probably benign 0.43
R3029:Atp8a2 UTSW 14 59691465 frame shift probably null
R3621:Atp8a2 UTSW 14 60026138 splice site probably null
R3768:Atp8a2 UTSW 14 60044336 missense probably benign 0.19
R3784:Atp8a2 UTSW 14 59773966 missense probably damaging 1.00
R3896:Atp8a2 UTSW 14 60026140 critical splice donor site probably null
R4009:Atp8a2 UTSW 14 60027985 missense possibly damaging 0.54
R4591:Atp8a2 UTSW 14 59654629 missense probably benign 0.03
R4866:Atp8a2 UTSW 14 59691467 missense probably damaging 1.00
R4879:Atp8a2 UTSW 14 60008469 nonsense probably null
R5059:Atp8a2 UTSW 14 59691537 missense probably benign 0.00
R5529:Atp8a2 UTSW 14 59793865 critical splice donor site probably null
R5788:Atp8a2 UTSW 14 60020793 missense probably damaging 0.96
R6126:Atp8a2 UTSW 14 60044326 missense probably benign
R6295:Atp8a2 UTSW 14 60012399 nonsense probably null
R6393:Atp8a2 UTSW 14 59773755 nonsense probably null
R6454:Atp8a2 UTSW 14 60008499 splice site probably null
R6651:Atp8a2 UTSW 14 59774021 missense probably benign 0.00
R6763:Atp8a2 UTSW 14 60008408 missense probably benign 0.12
R6767:Atp8a2 UTSW 14 60046722 missense probably damaging 1.00
R6912:Atp8a2 UTSW 14 60012410 missense probably benign 0.33
Z1088:Atp8a2 UTSW 14 60027970 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAGATGGTGGCTTCCCAAGGTAGG -3'
(R):5'- ATCCCACACAGCAGTGGATAGCAG -3'

Sequencing Primer
(F):5'- TTCCCAAGGTAGGCAGAGTC -3'
(R):5'- GTGTCCATGAACTTAGCGAAC -3'
Posted On2014-03-17