Incidental Mutation 'R1387:Kank3'
ID162462
Institutional Source Beutler Lab
Gene Symbol Kank3
Ensembl Gene ENSMUSG00000042099
Gene NameKN motif and ankyrin repeat domains 3
Synonyms0610013D04Rik, Ankrd47, D17Ertd288e
MMRRC Submission 039449-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R1387 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location33810520-33822918 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33816231 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 7 (N7S)
Ref Sequence ENSEMBL: ENSMUSP00000040126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048560] [ENSMUST00000172649] [ENSMUST00000173019] [ENSMUST00000173789]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048560
AA Change: N7S

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000040126
Gene: ENSMUSG00000042099
AA Change: N7S

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
Pfam:KN_motif 32 73 9.1e-24 PFAM
low complexity region 105 125 N/A INTRINSIC
low complexity region 138 150 N/A INTRINSIC
coiled coil region 180 229 N/A INTRINSIC
low complexity region 317 362 N/A INTRINSIC
low complexity region 369 385 N/A INTRINSIC
low complexity region 460 478 N/A INTRINSIC
low complexity region 485 498 N/A INTRINSIC
ANK 606 636 3.46e-4 SMART
ANK 640 674 2.88e2 SMART
ANK 679 708 5.41e-6 SMART
ANK 712 742 2.73e-2 SMART
Blast:ANK 746 775 4e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172649
SMART Domains Protein: ENSMUSP00000133760
Gene: ENSMUSG00000042099

DomainStartEndE-ValueType
coiled coil region 8 41 N/A INTRINSIC
low complexity region 129 174 N/A INTRINSIC
low complexity region 181 197 N/A INTRINSIC
low complexity region 272 290 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
ANK 418 448 3.46e-4 SMART
ANK 452 486 2.88e2 SMART
ANK 491 520 5.41e-6 SMART
ANK 524 554 2.73e-2 SMART
Blast:ANK 558 587 3e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173019
SMART Domains Protein: ENSMUSP00000134615
Gene: ENSMUSG00000067288

DomainStartEndE-ValueType
Pfam:Ribosomal_S28e 1 69 3.6e-37 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000173789
AA Change: N7S
SMART Domains Protein: ENSMUSP00000133625
Gene: ENSMUSG00000042099
AA Change: N7S

DomainStartEndE-ValueType
ANK 22 56 2.88e2 SMART
ANK 61 90 5.41e-6 SMART
ANK 94 124 2.73e-2 SMART
Blast:ANK 128 157 7e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173958
Meta Mutation Damage Score 0.092 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.4%
Validation Efficiency 99% (82/83)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610303G11Rik T A 9: 98,186,759 noncoding transcript Het
4930447C04Rik C A 12: 72,915,434 R52L probably benign Het
9930021J03Rik A G 19: 29,723,453 I812T probably benign Het
Abca13 C T 11: 9,682,085 Q5002* probably null Het
Acacb T C 5: 114,200,512 I761T probably benign Het
Acap3 G T 4: 155,899,480 L134F probably benign Het
Adamtsl1 T C 4: 86,374,993 probably benign Het
Adgrv1 A G 13: 81,493,176 V3278A possibly damaging Het
Agxt2 T C 15: 10,380,610 Y196H probably damaging Het
Akap13 T C 7: 75,586,193 V172A probably damaging Het
Aqp8 A G 7: 123,466,668 I229V probably benign Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Cacng8 T C 7: 3,415,156 S275P possibly damaging Het
Catsperg1 T C 7: 29,206,864 Y138C probably damaging Het
Ccdc93 T G 1: 121,491,189 L491R probably damaging Het
Cntnap2 T C 6: 47,107,914 V1103A probably benign Het
Col12a1 C T 9: 79,681,375 probably benign Het
Col6a3 A G 1: 90,822,416 probably benign Het
Csf2rb2 C T 15: 78,298,214 A6T probably damaging Het
Cyp2j5 T A 4: 96,634,285 S351C probably damaging Het
Cyth1 A G 11: 118,182,346 probably benign Het
Dock2 A G 11: 34,273,309 probably benign Het
Duoxa1 T A 2: 122,303,987 I262F possibly damaging Het
Dync2h1 T C 9: 7,125,816 D1930G probably benign Het
Elmsan1 C A 12: 84,152,931 R1005L probably damaging Het
Eno1 C T 4: 150,248,133 probably benign Het
Fam102a T C 2: 32,565,623 S254P possibly damaging Het
Fam98a T A 17: 75,538,269 H494L unknown Het
Fcamr C A 1: 130,804,642 T122K possibly damaging Het
Foxq1 A G 13: 31,559,305 D130G probably damaging Het
Glb1 T A 9: 114,420,363 W5R probably damaging Het
Gm17661 GA GAA 2: 90,917,709 noncoding transcript Het
Gm5431 T A 11: 48,895,015 R178W possibly damaging Het
Gys2 C T 6: 142,461,283 V116M probably benign Het
Hif1a C T 12: 73,942,292 T651I possibly damaging Het
Itgb5 T A 16: 33,900,515 Y3* probably null Het
Kdm2b G T 5: 122,880,268 H981Q probably damaging Het
Kdm6a C T X: 18,253,996 probably benign Het
Kif1a A T 1: 93,055,950 probably benign Het
Knl1 T A 2: 119,070,730 S971T possibly damaging Het
Lcn6 T C 2: 25,677,137 V50A possibly damaging Het
Llgl2 G T 11: 115,853,132 V762F probably damaging Het
Lpcat4 T C 2: 112,244,676 F342L probably benign Het
Lrp2 C A 2: 69,456,918 G3725V probably damaging Het
Map1b T C 13: 99,432,650 T1188A unknown Het
Mecp2 G A X: 74,035,788 P362S possibly damaging Het
Mmp13 T A 9: 7,282,033 F445Y possibly damaging Het
Myo5b G T 18: 74,644,201 probably benign Het
Myo7b A G 18: 31,983,752 probably benign Het
Nadk2 C A 15: 9,106,782 L384I possibly damaging Het
Napg A G 18: 62,986,212 I98V possibly damaging Het
Ncoa1 G T 12: 4,274,790 N1041K probably benign Het
Nmu A T 5: 76,350,145 C64* probably null Het
Nobox T A 6: 43,307,198 K13M probably damaging Het
Nos1 T C 5: 117,953,783 probably benign Het
Nrg2 A G 18: 36,196,739 V141A probably damaging Het
Olfr170 T C 16: 19,606,027 I214V probably damaging Het
Olfr362 T G 2: 37,104,868 I261L probably benign Het
Olfr544 T A 7: 102,484,704 I139L probably benign Het
Phldb2 C T 16: 45,825,994 E71K possibly damaging Het
Pik3r4 T A 9: 105,644,291 Y19N probably damaging Het
Pkhd1 A C 1: 20,555,223 probably benign Het
Pogk G T 1: 166,400,138 P148Q possibly damaging Het
Pten G T 19: 32,798,096 A79S probably benign Het
Ptpdc1 A T 13: 48,586,320 V545E possibly damaging Het
Qdpr G C 5: 45,450,138 probably benign Het
Rhbdd3 T A 11: 5,104,121 H83Q probably damaging Het
Rnf6 A G 5: 146,211,245 V321A probably benign Het
Rtf1 T A 2: 119,705,645 probably null Het
Serpina10 C T 12: 103,628,241 V240I probably benign Het
Siah2 A G 3: 58,691,514 V101A possibly damaging Het
Taok3 A G 5: 117,206,655 K46R probably damaging Het
Tcaf2 A C 6: 42,624,578 L849R probably damaging Het
Upf3a T C 8: 13,792,118 F178S probably damaging Het
Vmn1r218 G A 13: 23,137,308 G195D probably damaging Het
Vmn2r59 A G 7: 42,046,097 V297A probably damaging Het
Vmn2r70 T A 7: 85,558,761 Q836L probably benign Het
Zfp473 A G 7: 44,732,941 V655A probably benign Het
Zic5 A G 14: 122,459,485 S573P unknown Het
Other mutations in Kank3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Kank3 APN 17 33821817 missense probably damaging 1.00
IGL01105:Kank3 APN 17 33817401 missense probably damaging 1.00
IGL01106:Kank3 APN 17 33817401 missense probably damaging 1.00
IGL01139:Kank3 APN 17 33817401 missense probably damaging 1.00
IGL01595:Kank3 APN 17 33819180 critical splice donor site probably null
IGL02129:Kank3 APN 17 33817491 missense probably benign
IGL02364:Kank3 APN 17 33818850 missense probably benign
IGL02540:Kank3 APN 17 33819187 unclassified probably benign
R0940:Kank3 UTSW 17 33817476 missense probably damaging 1.00
R1663:Kank3 UTSW 17 33818375 missense probably benign 0.00
R1738:Kank3 UTSW 17 33817194 missense probably damaging 1.00
R1752:Kank3 UTSW 17 33819817 missense probably damaging 1.00
R4194:Kank3 UTSW 17 33822263 intron probably benign
R4921:Kank3 UTSW 17 33817200 missense probably damaging 1.00
R5001:Kank3 UTSW 17 33821772 missense possibly damaging 0.51
R5011:Kank3 UTSW 17 33822070 missense probably damaging 1.00
R5111:Kank3 UTSW 17 33818181 missense possibly damaging 0.82
R5147:Kank3 UTSW 17 33822202 missense probably damaging 1.00
R5282:Kank3 UTSW 17 33817943 missense probably benign 0.00
R5752:Kank3 UTSW 17 33818063 missense probably benign
R5943:Kank3 UTSW 17 33818401 missense probably damaging 1.00
R6027:Kank3 UTSW 17 33818114 missense possibly damaging 0.71
X0066:Kank3 UTSW 17 33817271 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGTGGCGTAACTGTTTGCTCAAAG -3'
(R):5'- CACGGGGAGTTGGGACATTAATTATGG -3'

Sequencing Primer
(F):5'- CTCAAAGTTTCAATGGTGGTGTAGC -3'
(R):5'- tttgtttgtttgtttgtttgcttg -3'
Posted On2014-03-17