Incidental Mutation 'R1387:Kdm6a'
ID162470
Institutional Source Beutler Lab
Gene Symbol Kdm6a
Ensembl Gene ENSMUSG00000037369
Gene Namelysine (K)-specific demethylase 6A
SynonymsUtx
MMRRC Submission 039449-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1387 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location18162575-18279936 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 18253996 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000044484] [ENSMUST00000052368] [ENSMUST00000223885] [ENSMUST00000224084] [ENSMUST00000224255]
Predicted Effect probably benign
Transcript: ENSMUST00000044484
SMART Domains Protein: ENSMUSP00000045862
Gene: ENSMUSG00000037369

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
low complexity region 28 42 N/A INTRINSIC
TPR 95 128 4.2e-2 SMART
TPR 132 165 6.1e-6 SMART
TPR 207 240 3.3e-2 SMART
TPR 286 319 2.3e-3 SMART
TPR 320 353 2e-5 SMART
TPR 354 387 7.7e-2 SMART
low complexity region 814 833 N/A INTRINSIC
low complexity region 919 932 N/A INTRINSIC
low complexity region 972 983 N/A INTRINSIC
low complexity region 1055 1071 N/A INTRINSIC
JmjC 1095 1258 3.9e-51 SMART
Blast:JmjC 1294 1358 7e-35 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000052368
SMART Domains Protein: ENSMUSP00000061539
Gene: ENSMUSG00000037369

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
low complexity region 28 42 N/A INTRINSIC
TPR 95 128 8.74e0 SMART
TPR 132 165 1.3e-3 SMART
TPR 207 240 7.01e0 SMART
TPR 286 319 4.69e-1 SMART
TPR 320 353 4.21e-3 SMART
TPR 354 387 1.6e1 SMART
low complexity region 814 833 N/A INTRINSIC
low complexity region 919 932 N/A INTRINSIC
low complexity region 972 983 N/A INTRINSIC
low complexity region 1055 1071 N/A INTRINSIC
JmjC 1095 1258 1.08e-48 SMART
Blast:JmjC 1294 1358 9e-35 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130978
Predicted Effect probably benign
Transcript: ENSMUST00000223885
Predicted Effect probably benign
Transcript: ENSMUST00000224084
Predicted Effect probably benign
Transcript: ENSMUST00000224255
Predicted Effect probably benign
Transcript: ENSMUST00000225336
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226046
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.4%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located on the X chromosome and is the corresponding locus to a Y-linked gene which encodes a tetratricopeptide repeat (TPR) protein. The encoded protein of this gene contains a JmjC-domain and catalyzes the demethylation of tri/dimethylated histone H3. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality, caudal body truncation, abnormal neural tube closure and abnormal heart development. Mice hemizygous for this allele exhibit perinatal lethality, abnormal neural tube closure, inability to breath, exencephaly and atelectasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610303G11Rik T A 9: 98,186,759 noncoding transcript Het
4930447C04Rik C A 12: 72,915,434 R52L probably benign Het
9930021J03Rik A G 19: 29,723,453 I812T probably benign Het
Abca13 C T 11: 9,682,085 Q5002* probably null Het
Acacb T C 5: 114,200,512 I761T probably benign Het
Acap3 G T 4: 155,899,480 L134F probably benign Het
Adamtsl1 T C 4: 86,374,993 probably benign Het
Adgrv1 A G 13: 81,493,176 V3278A possibly damaging Het
Agxt2 T C 15: 10,380,610 Y196H probably damaging Het
Akap13 T C 7: 75,586,193 V172A probably damaging Het
Aqp8 A G 7: 123,466,668 I229V probably benign Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Cacng8 T C 7: 3,415,156 S275P possibly damaging Het
Catsperg1 T C 7: 29,206,864 Y138C probably damaging Het
Ccdc93 T G 1: 121,491,189 L491R probably damaging Het
Cntnap2 T C 6: 47,107,914 V1103A probably benign Het
Col12a1 C T 9: 79,681,375 probably benign Het
Col6a3 A G 1: 90,822,416 probably benign Het
Csf2rb2 C T 15: 78,298,214 A6T probably damaging Het
Cyp2j5 T A 4: 96,634,285 S351C probably damaging Het
Cyth1 A G 11: 118,182,346 probably benign Het
Dock2 A G 11: 34,273,309 probably benign Het
Duoxa1 T A 2: 122,303,987 I262F possibly damaging Het
Dync2h1 T C 9: 7,125,816 D1930G probably benign Het
Elmsan1 C A 12: 84,152,931 R1005L probably damaging Het
Eno1 C T 4: 150,248,133 probably benign Het
Fam102a T C 2: 32,565,623 S254P possibly damaging Het
Fam98a T A 17: 75,538,269 H494L unknown Het
Fcamr C A 1: 130,804,642 T122K possibly damaging Het
Foxq1 A G 13: 31,559,305 D130G probably damaging Het
Glb1 T A 9: 114,420,363 W5R probably damaging Het
Gm17661 GA GAA 2: 90,917,709 noncoding transcript Het
Gm5431 T A 11: 48,895,015 R178W possibly damaging Het
Gys2 C T 6: 142,461,283 V116M probably benign Het
Hif1a C T 12: 73,942,292 T651I possibly damaging Het
Itgb5 T A 16: 33,900,515 Y3* probably null Het
Kank3 A G 17: 33,816,231 N7S possibly damaging Het
Kdm2b G T 5: 122,880,268 H981Q probably damaging Het
Kif1a A T 1: 93,055,950 probably benign Het
Knl1 T A 2: 119,070,730 S971T possibly damaging Het
Lcn6 T C 2: 25,677,137 V50A possibly damaging Het
Llgl2 G T 11: 115,853,132 V762F probably damaging Het
Lpcat4 T C 2: 112,244,676 F342L probably benign Het
Lrp2 C A 2: 69,456,918 G3725V probably damaging Het
Map1b T C 13: 99,432,650 T1188A unknown Het
Mecp2 G A X: 74,035,788 P362S possibly damaging Het
Mmp13 T A 9: 7,282,033 F445Y possibly damaging Het
Myo5b G T 18: 74,644,201 probably benign Het
Myo7b A G 18: 31,983,752 probably benign Het
Nadk2 C A 15: 9,106,782 L384I possibly damaging Het
Napg A G 18: 62,986,212 I98V possibly damaging Het
Ncoa1 G T 12: 4,274,790 N1041K probably benign Het
Nmu A T 5: 76,350,145 C64* probably null Het
Nobox T A 6: 43,307,198 K13M probably damaging Het
Nos1 T C 5: 117,953,783 probably benign Het
Nrg2 A G 18: 36,196,739 V141A probably damaging Het
Olfr170 T C 16: 19,606,027 I214V probably damaging Het
Olfr362 T G 2: 37,104,868 I261L probably benign Het
Olfr544 T A 7: 102,484,704 I139L probably benign Het
Phldb2 C T 16: 45,825,994 E71K possibly damaging Het
Pik3r4 T A 9: 105,644,291 Y19N probably damaging Het
Pkhd1 A C 1: 20,555,223 probably benign Het
Pogk G T 1: 166,400,138 P148Q possibly damaging Het
Pten G T 19: 32,798,096 A79S probably benign Het
Ptpdc1 A T 13: 48,586,320 V545E possibly damaging Het
Qdpr G C 5: 45,450,138 probably benign Het
Rhbdd3 T A 11: 5,104,121 H83Q probably damaging Het
Rnf6 A G 5: 146,211,245 V321A probably benign Het
Rtf1 T A 2: 119,705,645 probably null Het
Serpina10 C T 12: 103,628,241 V240I probably benign Het
Siah2 A G 3: 58,691,514 V101A possibly damaging Het
Taok3 A G 5: 117,206,655 K46R probably damaging Het
Tcaf2 A C 6: 42,624,578 L849R probably damaging Het
Upf3a T C 8: 13,792,118 F178S probably damaging Het
Vmn1r218 G A 13: 23,137,308 G195D probably damaging Het
Vmn2r59 A G 7: 42,046,097 V297A probably damaging Het
Vmn2r70 T A 7: 85,558,761 Q836L probably benign Het
Zfp473 A G 7: 44,732,941 V655A probably benign Het
Zic5 A G 14: 122,459,485 S573P unknown Het
Other mutations in Kdm6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00908:Kdm6a APN X 18236666 missense possibly damaging 0.94
IGL00963:Kdm6a APN X 18246426 splice site probably benign
IGL02072:Kdm6a APN X 18254289 missense probably benign 0.00
IGL02426:Kdm6a APN X 18246310 missense probably damaging 1.00
IGL03351:Kdm6a APN X 18247104 nonsense probably null
R0539:Kdm6a UTSW X 18262425 missense probably damaging 0.99
R1809:Kdm6a UTSW X 18236684 missense probably benign 0.44
R2238:Kdm6a UTSW X 18199237 missense probably damaging 0.99
R2239:Kdm6a UTSW X 18199237 missense probably damaging 0.99
R4062:Kdm6a UTSW X 18250875 missense probably benign
R4063:Kdm6a UTSW X 18250875 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGTTCAATATGGCTGAGAAATTCGCA -3'
(R):5'- AATTGCTAGGCAGGGTGGGATGT -3'

Sequencing Primer
(F):5'- GTGCTTTCTGTAAACTAATGTATGCC -3'
(R):5'- TCCATTCTGATTCTGAATACCAGAGC -3'
Posted On2014-03-17