Incidental Mutation 'R1388:2310050C09Rik'
ID162482
Institutional Source Beutler Lab
Gene Symbol 2310050C09Rik
Ensembl Gene ENSMUSG00000090314
Gene NameRIKEN cDNA 2310050C09 gene
Synonyms
MMRRC Submission 039450-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R1388 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location92868359-92870216 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 92869049 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 109 (T109K)
Ref Sequence ENSEMBL: ENSMUSP00000126921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163439]
Predicted Effect probably damaging
Transcript: ENSMUST00000163439
AA Change: T109K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126921
Gene: ENSMUSG00000090314
AA Change: T109K

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
internal_repeat_1 47 96 3.58e-12 PROSPERO
internal_repeat_1 104 151 3.58e-12 PROSPERO
low complexity region 152 171 N/A INTRINSIC
low complexity region 220 258 N/A INTRINSIC
Meta Mutation Damage Score 0.218 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.1%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot3 T G 12: 84,058,987 H409Q possibly damaging Het
Adgra1 T C 7: 139,874,003 V152A probably damaging Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Atxn7l3 C G 11: 102,292,435 probably benign Het
Ccdc174 C A 6: 91,881,244 probably null Het
Ccdc38 A T 10: 93,581,840 probably benign Het
Clca4b A T 3: 144,916,654 V550D probably benign Het
Dab2ip C T 2: 35,721,256 probably benign Het
Gm17661 GA GAA 2: 90,917,709 noncoding transcript Het
Gm2959 A T 14: 42,413,703 noncoding transcript Het
Gmnc A G 16: 26,963,912 L80P probably damaging Het
Gtf2ird1 T C 5: 134,395,710 D394G probably damaging Het
Heatr1 T C 13: 12,417,447 probably benign Het
Il1a T C 2: 129,306,581 S70G possibly damaging Het
Kctd19 T C 8: 105,392,051 S293G probably null Het
Klra4 T C 6: 130,062,235 probably benign Het
Mr1 T C 1: 155,132,503 E242G probably damaging Het
Mrnip C A 11: 50,196,945 A98E probably benign Het
Mybpc3 C T 2: 91,122,874 P155S probably benign Het
Myh14 A T 7: 44,665,122 Y126N probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr218 T C 1: 173,203,878 V174A probably benign Het
Olfr979 A G 9: 40,000,652 S192P probably damaging Het
Pnisr T C 4: 21,862,041 M243T possibly damaging Het
Ptprr A G 10: 116,273,752 S633G probably benign Het
Rasip1 T A 7: 45,630,232 S300T probably damaging Het
Sbsn A T 7: 30,752,151 H197L probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Sim1 T A 10: 50,895,994 I33N probably damaging Het
Speg A G 1: 75,430,460 D2878G probably damaging Het
Taf2 T A 15: 55,036,625 N864I probably benign Het
Tmem43 G T 6: 91,478,803 probably null Het
Ttn T C 2: 76,711,791 E25290G probably damaging Het
Ush2a A G 1: 188,523,318 probably benign Het
Usp53 T C 3: 122,957,628 E260G probably damaging Het
Vmn2r12 T G 5: 109,092,974 Y91S possibly damaging Het
Vmn2r59 A T 7: 42,045,709 N426K probably benign Het
Whamm C A 7: 81,586,290 L414I probably damaging Het
Zfhx4 A G 3: 5,401,387 T2227A probably damaging Het
Zfp866 C T 8: 69,766,184 R262Q probably benign Het
Other mutations in 2310050C09Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02056:2310050C09Rik APN 3 92868893 missense probably benign 0.17
R0421:2310050C09Rik UTSW 3 92868984 missense probably damaging 0.99
R2187:2310050C09Rik UTSW 3 92868615 missense probably damaging 1.00
R4213:2310050C09Rik UTSW 3 92869127 missense probably benign 0.01
R4240:2310050C09Rik UTSW 3 92868591 missense possibly damaging 0.89
R5394:2310050C09Rik UTSW 3 92868698 missense probably damaging 1.00
R6124:2310050C09Rik UTSW 3 92869058 missense probably damaging 1.00
R6804:2310050C09Rik UTSW 3 92869047 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- CTGAGCCACTTGAAGAAGCCTGAG -3'
(R):5'- TGTGTGACCAACAGAAGCAGCC -3'

Sequencing Primer
(F):5'- CCACTTGAAGAAGCCTGAGTATAG -3'
(R):5'- TTTCAGGCCAGATCCAAGCTG -3'
Posted On2014-03-17