Mutagenetix > Incidental Mutation

Incidental Mutation 'R1389:Itgae'

162545

Institutional Source

Beutler Lab

Gene Symbol

Itgae

Ensembl Gene

ENSMUSG00000005947

Gene Name

integrin alpha E, epithelial-associated

Synonyms

alpha-E1, CD103

MMRRC Submission

039451-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1389 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

72981409-73038272 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 73016188 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 799 (Y799C)

Ref Sequence

ENSEMBL: ENSMUSP00000099596 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006101] [ENSMUST00000102537]

AlphaFold

Q60677

Predicted Effect

probably damaging
Transcript: ENSMUST00000006101
AA Change: Y799C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000006101
Gene: ENSMUSG00000005947
AA Change: Y799C

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Blast:Int_alpha	36	118	1e-24	BLAST
VWA	193	380	1.13e-39	SMART
Int_alpha	448	496	1.49e-3	SMART
Int_alpha	502	559	6.83e-12	SMART
Int_alpha	565	626	1.79e-15	SMART
Int_alpha	633	685	6.29e0	SMART
transmembrane domain	1115	1137	N/A	INTRINSIC
Pfam:Integrin_alpha	1138	1152	1.1e-6	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000102537
AA Change: Y799C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099596
Gene: ENSMUSG00000005947
AA Change: Y799C

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Blast:Int_alpha	36	118	5e-25	BLAST
VWA	193	380	1.13e-39	SMART
Int_alpha	448	496	1.49e-3	SMART
Int_alpha	502	559	6.83e-12	SMART
Int_alpha	565	626	1.79e-15	SMART
Int_alpha	633	685	6.29e0	SMART

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.7%
20x: 90.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This gene encodes an I-domain-containing alpha integrin that undergoes post-translational cleavage in the extracellular domain, yielding disulfide-linked heavy and light chains. In combination with the beta 7 integrin, this protein forms the E-cadherin binding integrin known as the human mucosal lymphocyte-1 antigen. This protein is preferentially expressed in human intestinal intraepithelial lymphocytes (IEL), and in addition to a role in adhesion, it may serve as an accessory molecule for IEL activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reductions in the numbers of intestinal and vaginal intraepithelial lymphocytes and of T lymphocytes of the lamina propria. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abtb3	A	G	10: 85,476,460 (GRCm39)	T914A	possibly damaging	Het
Acsl3	A	C	1: 78,665,999 (GRCm39)	I142L	probably benign	Het
Adgra2	C	T	8: 27,601,116 (GRCm39)	P252L	probably damaging	Het
Akap6	A	G	12: 53,186,303 (GRCm39)	E1239G	probably benign	Het
Arhgef17	TGGAGGAGGAGGAGGAGG	TGGAGGAGGAGGAGG	7: 100,580,244 (GRCm39)		probably benign	Het
Calml4	A	T	9: 62,778,548 (GRCm39)	D12V	probably damaging	Het
Car9	G	T	4: 43,512,439 (GRCm39)		probably null	Het
Ccar2	C	A	14: 70,377,558 (GRCm39)	V699L	possibly damaging	Het
Ccdc27	T	C	4: 154,126,226 (GRCm39)	M88V	unknown	Het
Ceacam15	T	C	7: 16,405,988 (GRCm39)	R188G	probably damaging	Het
Dcaf8	G	A	1: 172,001,619 (GRCm39)	R272H	probably benign	Het
Dchs1	A	G	7: 105,404,778 (GRCm39)	V2588A	probably benign	Het
Dst	G	A	1: 34,250,313 (GRCm39)	R1749H	probably damaging	Het
Exog	A	G	9: 119,291,572 (GRCm39)	Q283R	probably benign	Het
Fmnl1	A	T	11: 103,077,535 (GRCm39)		probably null	Het
Gramd1c	T	C	16: 43,811,085 (GRCm39)	D213G	probably damaging	Het
Iqgap1	A	G	7: 80,409,504 (GRCm39)		probably null	Het
Kalrn	T	C	16: 33,809,173 (GRCm39)	I903V	probably benign	Het
Kcnh1	A	G	1: 192,188,071 (GRCm39)	E844G	probably benign	Het
Khdc1a	A	T	1: 21,420,251 (GRCm39)	D3V	probably damaging	Het
Ly6g	T	C	15: 75,028,615 (GRCm39)	F25S	probably benign	Het
Mapk1ip1	G	A	7: 138,438,456 (GRCm39)		probably benign	Het
Mfsd3	A	G	15: 76,586,889 (GRCm39)	H243R	probably benign	Het
Mms22l	T	A	4: 24,591,076 (GRCm39)	Y1016N	probably damaging	Het
Mrgprb5	A	T	7: 47,818,078 (GRCm39)	V219E	probably damaging	Het
Nars2	G	A	7: 96,652,036 (GRCm39)	S209N	probably benign	Het
Nckap5	T	C	1: 125,954,447 (GRCm39)	T702A	probably damaging	Het
Or1e26	T	C	11: 73,480,369 (GRCm39)	N65S	possibly damaging	Het
Paf1	A	G	7: 28,098,257 (GRCm39)		probably benign	Het
Prl3d1	A	T	13: 27,282,693 (GRCm39)	R145*	probably null	Het
Rasl10b	G	A	11: 83,308,665 (GRCm39)		probably null	Het
Rnf13	T	A	3: 57,686,917 (GRCm39)	N103K	probably damaging	Het
Senp1	T	C	15: 97,973,734 (GRCm39)	S170G	probably benign	Het
Slc46a2	A	G	4: 59,914,620 (GRCm39)	L101P	probably damaging	Het
Tmem123	C	T	9: 7,791,107 (GRCm39)	T136M	probably damaging	Het
Tpo	T	A	12: 30,153,109 (GRCm39)	H415L	probably damaging	Het
Vipr2	A	G	12: 116,100,950 (GRCm39)	I255V	probably benign	Het
Zc3h11a	A	T	1: 133,561,541 (GRCm39)	V310E	probably damaging	Het
Zfp3	T	A	11: 70,663,462 (GRCm39)	C474S	probably damaging	Het
Zfp707	T	A	15: 75,846,465 (GRCm39)	C99S	probably damaging	Het
Zranb1	C	T	7: 132,573,062 (GRCm39)	P410S	probably damaging	Het
Zswim8	G	T	14: 20,760,816 (GRCm39)	R30L	probably damaging	Het

Other mutations in Itgae

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00424:Itgae	APN	11	73,036,461 (GRCm39)	missense	probably benign	0.17
IGL00472:Itgae	APN	11	73,004,520 (GRCm39)	missense	probably benign	0.06
IGL00821:Itgae	APN	11	73,013,974 (GRCm39)	missense	probably damaging	1.00
IGL01625:Itgae	APN	11	73,010,263 (GRCm39)	missense	probably benign	0.00
IGL01639:Itgae	APN	11	73,010,204 (GRCm39)	missense	probably benign	0.00
IGL01743:Itgae	APN	11	73,002,585 (GRCm39)	missense	probably benign	0.02
IGL01911:Itgae	APN	11	73,006,963 (GRCm39)	missense	probably damaging	1.00
IGL01949:Itgae	APN	11	73,009,010 (GRCm39)	missense	probably benign	0.29
IGL02149:Itgae	APN	11	72,994,720 (GRCm39)	missense	probably benign	0.04
IGL02179:Itgae	APN	11	73,024,844 (GRCm39)	missense	probably benign	0.06
IGL02231:Itgae	APN	11	72,981,448 (GRCm39)	missense	possibly damaging	0.88
IGL02292:Itgae	APN	11	73,009,361 (GRCm39)	missense	probably damaging	0.98
IGL02378:Itgae	APN	11	73,008,947 (GRCm39)	missense	probably benign	0.00
IGL02525:Itgae	APN	11	73,021,777 (GRCm39)	missense	probably damaging	0.98
IGL02576:Itgae	APN	11	73,009,331 (GRCm39)	missense	possibly damaging	0.95
IGL02729:Itgae	APN	11	73,009,029 (GRCm39)	splice site	probably benign
IGL02859:Itgae	APN	11	73,005,693 (GRCm39)	missense	probably damaging	1.00
IGL03074:Itgae	APN	11	73,016,136 (GRCm39)	missense	probably benign	0.00
IGL03107:Itgae	APN	11	73,004,427 (GRCm39)	missense	probably damaging	1.00
IGL03264:Itgae	APN	11	73,006,400 (GRCm39)	missense	possibly damaging	0.73
IGL03272:Itgae	APN	11	73,024,680 (GRCm39)	splice site	probably null
IGL03352:Itgae	APN	11	73,022,556 (GRCm39)	missense	probably damaging	1.00
R0134:Itgae	UTSW	11	73,002,168 (GRCm39)	missense	probably benign	0.00
R0225:Itgae	UTSW	11	73,002,168 (GRCm39)	missense	probably benign	0.00
R0320:Itgae	UTSW	11	73,021,825 (GRCm39)	missense	possibly damaging	0.74
R0344:Itgae	UTSW	11	73,008,973 (GRCm39)	missense	probably benign	0.13
R0403:Itgae	UTSW	11	73,014,009 (GRCm39)	missense	possibly damaging	0.89
R0631:Itgae	UTSW	11	73,005,733 (GRCm39)	missense	probably damaging	1.00
R0833:Itgae	UTSW	11	73,020,032 (GRCm39)	missense	probably benign	0.02
R0836:Itgae	UTSW	11	73,020,032 (GRCm39)	missense	probably benign	0.02
R0973:Itgae	UTSW	11	73,029,335 (GRCm39)	nonsense	probably null
R1231:Itgae	UTSW	11	73,010,205 (GRCm39)	missense	probably benign	0.02
R1433:Itgae	UTSW	11	73,006,418 (GRCm39)	missense	probably damaging	1.00
R1534:Itgae	UTSW	11	73,036,431 (GRCm39)	missense	possibly damaging	0.58
R1833:Itgae	UTSW	11	73,007,988 (GRCm39)	missense	possibly damaging	0.94
R1914:Itgae	UTSW	11	73,009,469 (GRCm39)	splice site	probably benign
R1915:Itgae	UTSW	11	73,009,469 (GRCm39)	splice site	probably benign
R2061:Itgae	UTSW	11	73,009,448 (GRCm39)	missense	probably benign	0.00
R2380:Itgae	UTSW	11	73,036,395 (GRCm39)	missense	probably benign	0.00
R2435:Itgae	UTSW	11	73,012,763 (GRCm39)	nonsense	probably null
R2680:Itgae	UTSW	11	73,005,752 (GRCm39)	missense	probably damaging	1.00
R2886:Itgae	UTSW	11	73,031,513 (GRCm39)	missense	probably benign	0.04
R3873:Itgae	UTSW	11	73,004,442 (GRCm39)	missense	probably damaging	1.00
R3923:Itgae	UTSW	11	73,006,969 (GRCm39)	missense	probably damaging	0.99
R4010:Itgae	UTSW	11	73,002,165 (GRCm39)	missense	probably benign	0.00
R4059:Itgae	UTSW	11	73,002,960 (GRCm39)	missense	probably benign
R4212:Itgae	UTSW	11	73,010,178 (GRCm39)	missense	probably benign
R4213:Itgae	UTSW	11	73,010,178 (GRCm39)	missense	probably benign
R4691:Itgae	UTSW	11	73,010,345 (GRCm39)	nonsense	probably null
R4736:Itgae	UTSW	11	73,005,706 (GRCm39)	missense	possibly damaging	0.79
R5152:Itgae	UTSW	11	73,021,821 (GRCm39)	missense	probably damaging	1.00
R5201:Itgae	UTSW	11	73,001,382 (GRCm39)	missense	probably benign	0.00
R5307:Itgae	UTSW	11	73,036,464 (GRCm39)	missense	probably benign	0.00
R5362:Itgae	UTSW	11	73,002,675 (GRCm39)	missense	probably damaging	1.00
R5448:Itgae	UTSW	11	73,024,734 (GRCm39)	critical splice donor site	probably null
R5645:Itgae	UTSW	11	73,020,074 (GRCm39)	missense	probably damaging	1.00
R5672:Itgae	UTSW	11	73,036,377 (GRCm39)	missense	possibly damaging	0.96
R6079:Itgae	UTSW	11	73,006,400 (GRCm39)	missense	possibly damaging	0.73
R6138:Itgae	UTSW	11	73,006,400 (GRCm39)	missense	possibly damaging	0.73
R6226:Itgae	UTSW	11	73,031,583 (GRCm39)	missense	probably benign	0.11
R6244:Itgae	UTSW	11	73,036,427 (GRCm39)	missense	probably damaging	0.96
R6326:Itgae	UTSW	11	73,022,519 (GRCm39)	missense	possibly damaging	0.88
R6332:Itgae	UTSW	11	73,002,228 (GRCm39)	splice site	probably null
R6502:Itgae	UTSW	11	73,036,418 (GRCm39)	missense	probably benign	0.10
R6825:Itgae	UTSW	11	73,009,322 (GRCm39)	missense	possibly damaging	0.89
R7016:Itgae	UTSW	11	73,010,342 (GRCm39)	missense	probably damaging	0.99
R7020:Itgae	UTSW	11	73,002,195 (GRCm39)	missense	probably damaging	1.00
R7069:Itgae	UTSW	11	73,006,969 (GRCm39)	missense	probably damaging	0.99
R7132:Itgae	UTSW	11	73,002,184 (GRCm39)	missense	possibly damaging	0.93
R7473:Itgae	UTSW	11	73,031,504 (GRCm39)	missense	possibly damaging	0.87
R7599:Itgae	UTSW	11	73,012,786 (GRCm39)	missense	possibly damaging	0.62
R7637:Itgae	UTSW	11	73,004,457 (GRCm39)	missense	probably damaging	1.00
R7763:Itgae	UTSW	11	73,014,095 (GRCm39)	critical splice donor site	probably null
R7829:Itgae	UTSW	11	73,029,618 (GRCm39)	missense	probably benign
R7860:Itgae	UTSW	11	73,011,099 (GRCm39)	critical splice acceptor site	probably null
R7978:Itgae	UTSW	11	73,024,913 (GRCm39)	missense	probably damaging	0.98
R8197:Itgae	UTSW	11	73,011,210 (GRCm39)	missense	probably benign
R8911:Itgae	UTSW	11	73,004,447 (GRCm39)	missense	probably damaging	1.00
R9155:Itgae	UTSW	11	73,016,089 (GRCm39)	missense	possibly damaging	0.94
R9284:Itgae	UTSW	11	73,012,752 (GRCm39)	missense	probably benign	0.25
R9355:Itgae	UTSW	11	73,006,906 (GRCm39)	missense	probably damaging	1.00
R9414:Itgae	UTSW	11	73,002,629 (GRCm39)	missense	possibly damaging	0.59
R9595:Itgae	UTSW	11	73,016,182 (GRCm39)	missense	probably damaging	0.99
R9618:Itgae	UTSW	11	73,011,171 (GRCm39)	missense	possibly damaging	0.78
U15987:Itgae	UTSW	11	73,006,400 (GRCm39)	missense	possibly damaging	0.73
X0024:Itgae	UTSW	11	73,002,202 (GRCm39)	missense	probably benign	0.01
Z1186:Itgae	UTSW	11	72,994,713 (GRCm39)	missense	possibly damaging	0.74
Z1186:Itgae	UTSW	11	73,024,953 (GRCm39)	missense	probably benign	0.36
Z1186:Itgae	UTSW	11	73,012,783 (GRCm39)	missense	probably benign	0.00
Z1186:Itgae	UTSW	11	73,012,757 (GRCm39)	missense	probably benign	0.00
Z1186:Itgae	UTSW	11	73,008,913 (GRCm39)	missense	probably benign	0.01
Z1186:Itgae	UTSW	11	73,006,466 (GRCm39)	missense	probably benign
Z1186:Itgae	UTSW	11	72,994,786 (GRCm39)	missense	probably damaging	1.00
Z1187:Itgae	UTSW	11	72,994,713 (GRCm39)	missense	possibly damaging	0.74
Z1187:Itgae	UTSW	11	72,994,786 (GRCm39)	missense	probably damaging	1.00
Z1187:Itgae	UTSW	11	73,006,466 (GRCm39)	missense	probably benign
Z1187:Itgae	UTSW	11	73,008,913 (GRCm39)	missense	probably benign	0.01
Z1187:Itgae	UTSW	11	73,012,757 (GRCm39)	missense	probably benign	0.00
Z1187:Itgae	UTSW	11	73,012,783 (GRCm39)	missense	probably benign	0.00
Z1187:Itgae	UTSW	11	73,024,953 (GRCm39)	missense	probably benign	0.36
Z1188:Itgae	UTSW	11	72,994,713 (GRCm39)	missense	possibly damaging	0.74
Z1188:Itgae	UTSW	11	73,024,953 (GRCm39)	missense	probably benign	0.36
Z1188:Itgae	UTSW	11	73,012,783 (GRCm39)	missense	probably benign	0.00
Z1188:Itgae	UTSW	11	73,012,757 (GRCm39)	missense	probably benign	0.00
Z1188:Itgae	UTSW	11	73,008,913 (GRCm39)	missense	probably benign	0.01
Z1188:Itgae	UTSW	11	73,006,466 (GRCm39)	missense	probably benign
Z1188:Itgae	UTSW	11	72,994,786 (GRCm39)	missense	probably damaging	1.00
Z1189:Itgae	UTSW	11	72,994,713 (GRCm39)	missense	possibly damaging	0.74
Z1189:Itgae	UTSW	11	73,024,953 (GRCm39)	missense	probably benign	0.36
Z1189:Itgae	UTSW	11	73,012,783 (GRCm39)	missense	probably benign	0.00
Z1189:Itgae	UTSW	11	73,012,757 (GRCm39)	missense	probably benign	0.00
Z1189:Itgae	UTSW	11	73,008,913 (GRCm39)	missense	probably benign	0.01
Z1189:Itgae	UTSW	11	73,006,466 (GRCm39)	missense	probably benign
Z1189:Itgae	UTSW	11	72,994,786 (GRCm39)	missense	probably damaging	1.00
Z1190:Itgae	UTSW	11	73,024,953 (GRCm39)	missense	probably benign	0.36
Z1190:Itgae	UTSW	11	73,012,783 (GRCm39)	missense	probably benign	0.00
Z1190:Itgae	UTSW	11	73,012,757 (GRCm39)	missense	probably benign	0.00
Z1190:Itgae	UTSW	11	73,008,913 (GRCm39)	missense	probably benign	0.01
Z1190:Itgae	UTSW	11	73,006,466 (GRCm39)	missense	probably benign
Z1190:Itgae	UTSW	11	72,994,786 (GRCm39)	missense	probably damaging	1.00
Z1190:Itgae	UTSW	11	72,994,713 (GRCm39)	missense	possibly damaging	0.74
Z1191:Itgae	UTSW	11	73,024,953 (GRCm39)	missense	probably benign	0.36
Z1191:Itgae	UTSW	11	73,012,783 (GRCm39)	missense	probably benign	0.00
Z1191:Itgae	UTSW	11	73,012,757 (GRCm39)	missense	probably benign	0.00
Z1191:Itgae	UTSW	11	73,008,913 (GRCm39)	missense	probably benign	0.01
Z1191:Itgae	UTSW	11	73,006,466 (GRCm39)	missense	probably benign
Z1191:Itgae	UTSW	11	72,994,786 (GRCm39)	missense	probably damaging	1.00
Z1191:Itgae	UTSW	11	72,994,713 (GRCm39)	missense	possibly damaging	0.74
Z1192:Itgae	UTSW	11	73,012,783 (GRCm39)	missense	probably benign	0.00
Z1192:Itgae	UTSW	11	73,012,757 (GRCm39)	missense	probably benign	0.00
Z1192:Itgae	UTSW	11	73,008,913 (GRCm39)	missense	probably benign	0.01
Z1192:Itgae	UTSW	11	73,006,466 (GRCm39)	missense	probably benign
Z1192:Itgae	UTSW	11	72,994,786 (GRCm39)	missense	probably damaging	1.00
Z1192:Itgae	UTSW	11	72,994,713 (GRCm39)	missense	possibly damaging	0.74
Z1192:Itgae	UTSW	11	73,024,953 (GRCm39)	missense	probably benign	0.36

Predicted Primers

PCR Primer
(F):5'- CTTGTTTGCGCTCCACACAAAGTC -3'
(R):5'- CTTCCTTGCTGACAGTCTGAAGACC -3'

Sequencing Primer
(F):5'- AGCTAGAATCCCTTTGTGACTG -3'
(R):5'- TGACAGTCTGAAGACCCTCCC -3'

Posted On

2014-03-17