Incidental Mutation 'R1390:Galnt3'
ID 162565
Institutional Source Beutler Lab
Gene Symbol Galnt3
Ensembl Gene ENSMUSG00000026994
Gene Name polypeptide N-acetylgalactosaminyltransferase 3
Synonyms ppGaNTase-T3
MMRRC Submission 039452-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.376) question?
Stock # R1390 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 65913110-65955217 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 65921567 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 488 (Y488C)
Ref Sequence ENSEMBL: ENSMUSP00000028378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028378]
AlphaFold P70419
Predicted Effect probably damaging
Transcript: ENSMUST00000028378
AA Change: Y488C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028378
Gene: ENSMUSG00000026994
AA Change: Y488C

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
coiled coil region 44 75 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 185 440 8.3e-10 PFAM
Pfam:Glycos_transf_2 188 374 1.2e-35 PFAM
Pfam:Glyco_transf_7C 345 423 7.7e-14 PFAM
RICIN 506 630 2.71e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155453
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes UDP-GalNAc transferase 3, a member of the GalNAc-transferases family. This family transfers an N-acetyl galactosamine to the hydroxyl group of a serine or threonine residue in the first step of O-linked oligosaccharide biosynthesis. Individual GalNAc-transferases have distinct activities and initiation of O-glycosylation is regulated by a repertoire of GalNAc-transferases. The protein encoded by this gene is highly homologous to other family members, however the enzymes have different substrate specificities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased circulating alkaline phosphatase, hypercalcemia, hyperphosphatemia, decreased circulating parathyroid hormone, and male specific postnatal growth retardation, infertility, and increase in bone density. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy2 T A 13: 68,805,512 (GRCm39) I819F possibly damaging Het
Carm1 T A 9: 21,490,789 (GRCm39) M219K probably damaging Het
Casd1 T C 6: 4,641,859 (GRCm39) I712T probably benign Het
Dido1 A G 2: 180,326,917 (GRCm39) V402A possibly damaging Het
Frem3 T C 8: 81,417,402 (GRCm39) S2036P probably damaging Het
Ints8 A T 4: 11,239,461 (GRCm39) I288K probably benign Het
Mcmbp A C 7: 128,325,865 (GRCm39) M71R probably damaging Het
Nid1 T G 13: 13,650,831 (GRCm39) L456R probably damaging Het
Obscn T C 11: 58,984,274 (GRCm39) D1752G probably damaging Het
Or4f47 A G 2: 111,972,952 (GRCm39) I221V probably benign Het
Osbpl3 T A 6: 50,285,407 (GRCm39) D647V probably damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,558,948 (GRCm39) probably benign Het
Shank1 G T 7: 44,006,462 (GRCm39) G2060W probably damaging Het
Skint5 A G 4: 113,512,881 (GRCm39) S884P unknown Het
Slit2 G A 5: 48,374,832 (GRCm39) S370N probably benign Het
Sorcs3 G A 19: 48,682,440 (GRCm39) probably null Het
Strip2 G T 6: 29,929,828 (GRCm39) R305L probably damaging Het
Trim30d T C 7: 104,132,610 (GRCm39) R226G probably benign Het
Vmn1r173 T G 7: 23,402,323 (GRCm39) V186G possibly damaging Het
Zfp719 A G 7: 43,239,867 (GRCm39) D485G possibly damaging Het
Other mutations in Galnt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Galnt3 APN 2 65,925,628 (GRCm39) missense probably damaging 1.00
IGL01563:Galnt3 APN 2 65,928,101 (GRCm39) missense probably damaging 0.97
IGL01973:Galnt3 APN 2 65,914,606 (GRCm39) missense probably benign 0.03
IGL02004:Galnt3 APN 2 65,926,270 (GRCm39) missense probably damaging 1.00
IGL02424:Galnt3 APN 2 65,926,132 (GRCm39) critical splice donor site probably null
IGL02946:Galnt3 APN 2 65,925,562 (GRCm39) missense probably damaging 0.99
IGL03059:Galnt3 APN 2 65,923,954 (GRCm39) missense probably damaging 1.00
PIT4531001:Galnt3 UTSW 2 65,937,432 (GRCm39) missense probably benign 0.03
R0437:Galnt3 UTSW 2 65,937,573 (GRCm39) missense possibly damaging 0.74
R1536:Galnt3 UTSW 2 65,914,550 (GRCm39) missense probably damaging 1.00
R1869:Galnt3 UTSW 2 65,928,123 (GRCm39) missense possibly damaging 0.82
R2987:Galnt3 UTSW 2 65,914,585 (GRCm39) missense probably benign 0.00
R3973:Galnt3 UTSW 2 65,937,374 (GRCm39) missense possibly damaging 0.77
R4039:Galnt3 UTSW 2 65,915,671 (GRCm39) missense probably damaging 0.96
R4515:Galnt3 UTSW 2 65,923,954 (GRCm39) missense probably damaging 1.00
R4518:Galnt3 UTSW 2 65,923,954 (GRCm39) missense probably damaging 1.00
R4519:Galnt3 UTSW 2 65,923,954 (GRCm39) missense probably damaging 1.00
R4577:Galnt3 UTSW 2 65,928,203 (GRCm39) missense probably benign 0.02
R4817:Galnt3 UTSW 2 65,923,883 (GRCm39) missense possibly damaging 0.83
R5008:Galnt3 UTSW 2 65,915,585 (GRCm39) missense probably benign 0.04
R5191:Galnt3 UTSW 2 65,924,050 (GRCm39) missense probably damaging 1.00
R5947:Galnt3 UTSW 2 65,914,500 (GRCm39) utr 3 prime probably benign
R6534:Galnt3 UTSW 2 65,932,875 (GRCm39) missense probably damaging 1.00
R7196:Galnt3 UTSW 2 65,921,268 (GRCm39) missense probably damaging 1.00
R7817:Galnt3 UTSW 2 65,926,243 (GRCm39) missense probably damaging 1.00
R7951:Galnt3 UTSW 2 65,928,186 (GRCm39) missense probably benign 0.00
R7952:Galnt3 UTSW 2 65,928,186 (GRCm39) missense probably benign 0.00
R8071:Galnt3 UTSW 2 65,921,555 (GRCm39) missense probably benign 0.28
R8513:Galnt3 UTSW 2 65,924,064 (GRCm39) nonsense probably null
R8844:Galnt3 UTSW 2 65,915,636 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAATCAATGGTTTGCCTCCCTGG -3'
(R):5'- GCACACCTGTGGCTTACATGAATGG -3'

Sequencing Primer
(F):5'- TGGTTATTCTCACCAACATCCAGAC -3'
(R):5'- GGCATTTGAAGTCCATCCAG -3'
Posted On 2014-03-17