Mutagenetix > Incidental Mutation

Incidental Mutation 'R1390:Ints8'

162569

Institutional Source

Beutler Lab

Gene Symbol

Ints8

Ensembl Gene

ENSMUSG00000040738

Gene Name

integrator complex subunit 8

Synonyms

2810013E07Rik, D130008D20Rik

MMRRC Submission

039452-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.962) question?

Stock #

R1390 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

11199158-11254258 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 11239461 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 288 (I288K)

Ref Sequence

ENSEMBL: ENSMUSP00000103955 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044616] [ENSMUST00000108318] [ENSMUST00000108319]

AlphaFold

Q80V86

Predicted Effect

probably benign
Transcript: ENSMUST00000044616
AA Change: I288K

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000038418
Gene: ENSMUSG00000040738
AA Change: I288K

Domain	Start	End	E-Value	Type
low complexity region	25	35	N/A	INTRINSIC
low complexity region	80	93	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108318
AA Change: I288K

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000103954
Gene: ENSMUSG00000040738
AA Change: I288K

Domain	Start	End	E-Value	Type
low complexity region	25	35	N/A	INTRINSIC
low complexity region	80	93	N/A	INTRINSIC
SCOP:d1a17__	826	961	9e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000108319
AA Change: I288K

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000103955
Gene: ENSMUSG00000040738
AA Change: I288K

Domain	Start	End	E-Value	Type
low complexity region	25	35	N/A	INTRINSIC
low complexity region	80	93	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137054

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147372

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.8%
20x: 90.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the Integrator complex which is involved in the cleavage of small nuclear RNAs U1 and U2 within the nucleus. The encoded protein associates with RNA polymerase II and is recruited to the U1 and U2 small nuclear RNA genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]

Allele List at MGI

All alleles(14) : Targeted(1) Gene trapped(13)

Other mutations in this stock

Total: 20 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy2	T	A	13: 68,805,512 (GRCm39)	I819F	possibly damaging	Het
Carm1	T	A	9: 21,490,789 (GRCm39)	M219K	probably damaging	Het
Casd1	T	C	6: 4,641,859 (GRCm39)	I712T	probably benign	Het
Dido1	A	G	2: 180,326,917 (GRCm39)	V402A	possibly damaging	Het
Frem3	T	C	8: 81,417,402 (GRCm39)	S2036P	probably damaging	Het
Galnt3	T	C	2: 65,921,567 (GRCm39)	Y488C	probably damaging	Het
Mcmbp	A	C	7: 128,325,865 (GRCm39)	M71R	probably damaging	Het
Nid1	T	G	13: 13,650,831 (GRCm39)	L456R	probably damaging	Het
Obscn	T	C	11: 58,984,274 (GRCm39)	D1752G	probably damaging	Het
Or4f47	A	G	2: 111,972,952 (GRCm39)	I221V	probably benign	Het
Osbpl3	T	A	6: 50,285,407 (GRCm39)	D647V	probably damaging	Het
Rbpms2	ACTGCTGCTGCTGCTGC	ACTGCTGCTGCTGCTGCTGC	9: 65,558,948 (GRCm39)		probably benign	Het
Shank1	G	T	7: 44,006,462 (GRCm39)	G2060W	probably damaging	Het
Skint5	A	G	4: 113,512,881 (GRCm39)	S884P	unknown	Het
Slit2	G	A	5: 48,374,832 (GRCm39)	S370N	probably benign	Het
Sorcs3	G	A	19: 48,682,440 (GRCm39)		probably null	Het
Strip2	G	T	6: 29,929,828 (GRCm39)	R305L	probably damaging	Het
Trim30d	T	C	7: 104,132,610 (GRCm39)	R226G	probably benign	Het
Vmn1r173	T	G	7: 23,402,323 (GRCm39)	V186G	possibly damaging	Het
Zfp719	A	G	7: 43,239,867 (GRCm39)	D485G	possibly damaging	Het

Other mutations in Ints8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01390:Ints8	APN	4	11,218,679 (GRCm39)	splice site	probably benign
IGL01925:Ints8	APN	4	11,235,617 (GRCm39)	splice site	probably benign
IGL02195:Ints8	APN	4	11,221,222 (GRCm39)	missense	probably damaging	1.00
IGL02215:Ints8	APN	4	11,209,244 (GRCm39)	missense	probably damaging	1.00
IGL02429:Ints8	APN	4	11,231,720 (GRCm39)	missense	probably damaging	1.00
IGL02484:Ints8	APN	4	11,208,834 (GRCm39)	nonsense	probably null
IGL02558:Ints8	APN	4	11,218,771 (GRCm39)	missense	probably damaging	1.00
IGL02725:Ints8	APN	4	11,239,406 (GRCm39)	missense	probably benign	0.01
IGL02742:Ints8	APN	4	11,241,627 (GRCm39)	missense	possibly damaging	0.75
IGL02831:Ints8	APN	4	11,245,896 (GRCm39)	missense	possibly damaging	0.51
IGL03140:Ints8	APN	4	11,235,565 (GRCm39)	missense	probably damaging	1.00
IGL03171:Ints8	APN	4	11,231,702 (GRCm39)	missense	probably benign	0.01
IGL03335:Ints8	APN	4	11,216,460 (GRCm39)	missense	probably damaging	1.00
G1Funyon:Ints8	UTSW	4	11,246,120 (GRCm39)	missense	probably damaging	1.00
P0026:Ints8	UTSW	4	11,225,788 (GRCm39)	nonsense	probably null
R0054:Ints8	UTSW	4	11,204,595 (GRCm39)	utr 3 prime	probably benign
R0063:Ints8	UTSW	4	11,252,857 (GRCm39)	missense	probably damaging	1.00
R0063:Ints8	UTSW	4	11,252,857 (GRCm39)	missense	probably damaging	1.00
R0184:Ints8	UTSW	4	11,218,637 (GRCm39)	missense	probably benign	0.03
R0299:Ints8	UTSW	4	11,246,097 (GRCm39)	missense	probably benign	0.04
R0499:Ints8	UTSW	4	11,246,097 (GRCm39)	missense	probably benign	0.04
R0540:Ints8	UTSW	4	11,252,926 (GRCm39)	missense	possibly damaging	0.94
R0657:Ints8	UTSW	4	11,246,097 (GRCm39)	missense	probably benign	0.04
R1232:Ints8	UTSW	4	11,234,587 (GRCm39)	missense	possibly damaging	0.81
R1296:Ints8	UTSW	4	11,221,204 (GRCm39)	missense	possibly damaging	0.95
R1503:Ints8	UTSW	4	11,245,842 (GRCm39)	missense	probably damaging	0.97
R1587:Ints8	UTSW	4	11,245,722 (GRCm39)	critical splice donor site	probably null
R1701:Ints8	UTSW	4	11,231,656 (GRCm39)	missense	probably damaging	1.00
R1721:Ints8	UTSW	4	11,241,684 (GRCm39)	missense	probably damaging	0.97
R1757:Ints8	UTSW	4	11,254,109 (GRCm39)	start codon destroyed	probably null	0.99
R1777:Ints8	UTSW	4	11,225,600 (GRCm39)	critical splice donor site	probably null
R1867:Ints8	UTSW	4	11,241,684 (GRCm39)	missense	probably damaging	0.97
R1868:Ints8	UTSW	4	11,241,684 (GRCm39)	missense	probably damaging	0.97
R1952:Ints8	UTSW	4	11,221,150 (GRCm39)	missense	probably benign	0.21
R2084:Ints8	UTSW	4	11,230,377 (GRCm39)	missense	probably benign	0.31
R2108:Ints8	UTSW	4	11,235,552 (GRCm39)	missense	probably damaging	0.99
R2202:Ints8	UTSW	4	11,225,712 (GRCm39)	missense	possibly damaging	0.79
R2203:Ints8	UTSW	4	11,225,712 (GRCm39)	missense	possibly damaging	0.79
R2205:Ints8	UTSW	4	11,225,712 (GRCm39)	missense	possibly damaging	0.79
R2439:Ints8	UTSW	4	11,225,725 (GRCm39)	missense	probably benign	0.29
R2504:Ints8	UTSW	4	11,241,642 (GRCm39)	missense	probably benign	0.03
R3824:Ints8	UTSW	4	11,225,621 (GRCm39)	nonsense	probably null
R4664:Ints8	UTSW	4	11,227,152 (GRCm39)	missense	probably benign	0.04
R4703:Ints8	UTSW	4	11,223,785 (GRCm39)	missense	possibly damaging	0.92
R4895:Ints8	UTSW	4	11,230,367 (GRCm39)	nonsense	probably null
R5206:Ints8	UTSW	4	11,216,477 (GRCm39)	missense	possibly damaging	0.65
R5262:Ints8	UTSW	4	11,211,916 (GRCm39)	missense	probably damaging	1.00
R5505:Ints8	UTSW	4	11,221,143 (GRCm39)	missense	probably benign	0.18
R5513:Ints8	UTSW	4	11,248,303 (GRCm39)	missense	possibly damaging	0.79
R5750:Ints8	UTSW	4	11,241,654 (GRCm39)	missense	possibly damaging	0.81
R5892:Ints8	UTSW	4	11,223,813 (GRCm39)	missense	probably damaging	1.00
R6007:Ints8	UTSW	4	11,208,845 (GRCm39)	missense	possibly damaging	0.70
R6229:Ints8	UTSW	4	11,252,891 (GRCm39)	missense	probably damaging	1.00
R6466:Ints8	UTSW	4	11,252,878 (GRCm39)	missense	probably damaging	0.99
R6709:Ints8	UTSW	4	11,221,117 (GRCm39)	missense	possibly damaging	0.65
R6986:Ints8	UTSW	4	11,204,474 (GRCm39)	missense	probably damaging	1.00
R6998:Ints8	UTSW	4	11,204,537 (GRCm39)	missense	possibly damaging	0.80
R7074:Ints8	UTSW	4	11,204,574 (GRCm39)	missense	possibly damaging	0.82
R7221:Ints8	UTSW	4	11,225,613 (GRCm39)	missense	probably benign	0.01
R7772:Ints8	UTSW	4	11,227,190 (GRCm39)	missense	probably damaging	0.97
R7872:Ints8	UTSW	4	11,254,062 (GRCm39)	missense	probably benign	0.00
R7953:Ints8	UTSW	4	11,227,128 (GRCm39)	missense	probably benign
R8184:Ints8	UTSW	4	11,204,534 (GRCm39)	missense	probably damaging	1.00
R8301:Ints8	UTSW	4	11,246,120 (GRCm39)	missense	probably damaging	1.00
R8708:Ints8	UTSW	4	11,208,824 (GRCm39)	critical splice donor site	probably null
R8868:Ints8	UTSW	4	11,230,488 (GRCm39)	missense	probably benign
R9245:Ints8	UTSW	4	11,213,811 (GRCm39)	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- AGCCACACTTGGCAAACAGTGATAG -3'
(R):5'- AATGATGTTCTGCCGATCTCTGCTC -3'

Sequencing Primer
(F):5'- GCAGGATCTGAACATAGTTTGTTTC -3'
(R):5'- GCACTAAGGAGTACTAGTCTGTT -3'

Posted On

2014-03-17