Incidental Mutation 'R1390:Carm1'
ID 162586
Institutional Source Beutler Lab
Gene Symbol Carm1
Ensembl Gene ENSMUSG00000032185
Gene Name coactivator-associated arginine methyltransferase 1
Synonyms m9Bei, Prmt4
MMRRC Submission 039452-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1390 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 21458163-21500763 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 21490789 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 219 (M219K)
Ref Sequence ENSEMBL: ENSMUSP00000111053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034703] [ENSMUST00000115394] [ENSMUST00000115395] [ENSMUST00000130032]
AlphaFold Q9WVG6
Predicted Effect probably damaging
Transcript: ENSMUST00000034703
AA Change: M219K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034703
Gene: ENSMUSG00000032185
AA Change: M219K

DomainStartEndE-ValueType
Pfam:CARM1 27 140 2.1e-71 PFAM
Pfam:PRMT5 144 447 2.3e-16 PFAM
Pfam:MTS 166 308 2.7e-10 PFAM
Pfam:Methyltransf_9 168 318 1.1e-9 PFAM
Pfam:PrmA 173 287 2.2e-12 PFAM
Pfam:Methyltransf_31 183 325 7.4e-11 PFAM
Pfam:Methyltransf_18 185 290 5.1e-12 PFAM
Pfam:Methyltransf_26 186 287 5.3e-10 PFAM
Pfam:Methyltransf_11 190 287 8.5e-7 PFAM
low complexity region 477 494 N/A INTRINSIC
low complexity region 562 576 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115394
AA Change: M219K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111052
Gene: ENSMUSG00000032185
AA Change: M219K

DomainStartEndE-ValueType
Pfam:CARM1 29 140 4.7e-63 PFAM
Pfam:PRMT5 145 447 4.1e-16 PFAM
Pfam:Methyltransf_9 168 318 1.4e-9 PFAM
Pfam:MTS 170 299 2.5e-9 PFAM
Pfam:PrmA 175 287 3.7e-12 PFAM
Pfam:Methyltransf_31 183 326 1.9e-10 PFAM
Pfam:Methyltransf_18 185 290 4e-9 PFAM
Pfam:Methyltransf_11 190 287 6.5e-7 PFAM
low complexity region 477 494 N/A INTRINSIC
low complexity region 606 619 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115395
AA Change: M219K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111053
Gene: ENSMUSG00000032185
AA Change: M219K

DomainStartEndE-ValueType
Pfam:CARM1 27 140 2e-71 PFAM
Pfam:PRMT5 144 447 2.1e-16 PFAM
Pfam:MTS 166 308 2.6e-10 PFAM
Pfam:Methyltransf_9 168 318 1.1e-9 PFAM
Pfam:PrmA 172 287 2.1e-12 PFAM
Pfam:Methyltransf_31 183 326 6.9e-11 PFAM
Pfam:Methyltransf_18 185 290 4.8e-12 PFAM
Pfam:Methyltransf_26 186 287 5e-10 PFAM
Pfam:Methyltransf_11 190 287 8.1e-7 PFAM
low complexity region 477 494 N/A INTRINSIC
low complexity region 540 553 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130032
SMART Domains Protein: ENSMUSP00000117243
Gene: ENSMUSG00000032185

DomainStartEndE-ValueType
Pfam:CARM1 27 140 2.8e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139871
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147749
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154049
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protein arginine methyltransferase (PRMT) family. The encoded enzyme catalyzes the methylation of guanidino nitrogens of arginyl residues of proteins. The enzyme acts specifically on histones and other chromatin-associated proteins and is involved in regulation of gene expression. The enzyme may act in association with other proteins or within multi-protein complexes and may play a role in cell type-specific functions and cell lineage specification. A related pseudogene is located on chromosome 9. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous null fetuses are small and die perinatally, whereas heterozygotes are born at the expected Mendelian ratio but show decreased survival through weaning. Mice homozygous for a kinase null allele exhibit neonatal lethality, arrested T cell development, and impaired adipogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy2 T A 13: 68,805,512 (GRCm39) I819F possibly damaging Het
Casd1 T C 6: 4,641,859 (GRCm39) I712T probably benign Het
Dido1 A G 2: 180,326,917 (GRCm39) V402A possibly damaging Het
Frem3 T C 8: 81,417,402 (GRCm39) S2036P probably damaging Het
Galnt3 T C 2: 65,921,567 (GRCm39) Y488C probably damaging Het
Ints8 A T 4: 11,239,461 (GRCm39) I288K probably benign Het
Mcmbp A C 7: 128,325,865 (GRCm39) M71R probably damaging Het
Nid1 T G 13: 13,650,831 (GRCm39) L456R probably damaging Het
Obscn T C 11: 58,984,274 (GRCm39) D1752G probably damaging Het
Or4f47 A G 2: 111,972,952 (GRCm39) I221V probably benign Het
Osbpl3 T A 6: 50,285,407 (GRCm39) D647V probably damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,558,948 (GRCm39) probably benign Het
Shank1 G T 7: 44,006,462 (GRCm39) G2060W probably damaging Het
Skint5 A G 4: 113,512,881 (GRCm39) S884P unknown Het
Slit2 G A 5: 48,374,832 (GRCm39) S370N probably benign Het
Sorcs3 G A 19: 48,682,440 (GRCm39) probably null Het
Strip2 G T 6: 29,929,828 (GRCm39) R305L probably damaging Het
Trim30d T C 7: 104,132,610 (GRCm39) R226G probably benign Het
Vmn1r173 T G 7: 23,402,323 (GRCm39) V186G possibly damaging Het
Zfp719 A G 7: 43,239,867 (GRCm39) D485G possibly damaging Het
Other mutations in Carm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:Carm1 APN 9 21,498,490 (GRCm39) missense possibly damaging 0.62
IGL01360:Carm1 APN 9 21,498,598 (GRCm39) missense probably benign 0.19
IGL01401:Carm1 APN 9 21,480,878 (GRCm39) critical splice donor site probably null
IGL02218:Carm1 APN 9 21,480,808 (GRCm39) missense probably damaging 1.00
IGL02436:Carm1 APN 9 21,490,758 (GRCm39) missense probably damaging 1.00
IGL02601:Carm1 APN 9 21,498,204 (GRCm39) missense probably damaging 1.00
R0551:Carm1 UTSW 9 21,491,787 (GRCm39) splice site probably null
R0580:Carm1 UTSW 9 21,494,880 (GRCm39) missense probably damaging 1.00
R0724:Carm1 UTSW 9 21,498,670 (GRCm39) missense probably damaging 1.00
R0883:Carm1 UTSW 9 21,480,887 (GRCm39) splice site probably benign
R1713:Carm1 UTSW 9 21,497,785 (GRCm39) missense probably damaging 0.97
R1950:Carm1 UTSW 9 21,485,812 (GRCm39) missense probably benign 0.01
R1960:Carm1 UTSW 9 21,491,606 (GRCm39) missense probably benign 0.40
R2402:Carm1 UTSW 9 21,494,836 (GRCm39) missense probably damaging 1.00
R2512:Carm1 UTSW 9 21,486,708 (GRCm39) critical splice acceptor site probably null
R2520:Carm1 UTSW 9 21,494,893 (GRCm39) splice site probably null
R2939:Carm1 UTSW 9 21,490,692 (GRCm39) splice site probably null
R2940:Carm1 UTSW 9 21,490,692 (GRCm39) splice site probably null
R3081:Carm1 UTSW 9 21,490,692 (GRCm39) splice site probably null
R3407:Carm1 UTSW 9 21,497,478 (GRCm39) missense probably damaging 1.00
R3434:Carm1 UTSW 9 21,480,769 (GRCm39) missense probably damaging 1.00
R3808:Carm1 UTSW 9 21,498,258 (GRCm39) missense probably damaging 1.00
R4504:Carm1 UTSW 9 21,480,822 (GRCm39) missense probably damaging 1.00
R4700:Carm1 UTSW 9 21,498,480 (GRCm39) missense probably benign 0.12
R5019:Carm1 UTSW 9 21,490,807 (GRCm39) critical splice donor site probably null
R5362:Carm1 UTSW 9 21,498,655 (GRCm39) missense probably benign 0.03
R5661:Carm1 UTSW 9 21,498,295 (GRCm39) missense probably benign 0.10
R5730:Carm1 UTSW 9 21,491,636 (GRCm39) missense probably benign 0.37
R5913:Carm1 UTSW 9 21,498,848 (GRCm39) missense probably benign 0.01
R5928:Carm1 UTSW 9 21,486,598 (GRCm39) intron probably benign
R6370:Carm1 UTSW 9 21,498,815 (GRCm39) missense probably benign 0.11
R6431:Carm1 UTSW 9 21,494,373 (GRCm39) missense probably damaging 1.00
R6555:Carm1 UTSW 9 21,498,258 (GRCm39) missense probably damaging 1.00
R7177:Carm1 UTSW 9 21,458,323 (GRCm39) missense unknown
R7235:Carm1 UTSW 9 21,498,701 (GRCm39) critical splice donor site probably benign
R7249:Carm1 UTSW 9 21,497,505 (GRCm39) missense probably benign
R7576:Carm1 UTSW 9 21,497,832 (GRCm39) critical splice donor site probably null
R7650:Carm1 UTSW 9 21,491,668 (GRCm39) missense probably benign 0.00
R7664:Carm1 UTSW 9 21,498,286 (GRCm39) missense probably benign 0.01
R8359:Carm1 UTSW 9 21,480,765 (GRCm39) missense possibly damaging 0.51
R8683:Carm1 UTSW 9 21,497,464 (GRCm39) missense possibly damaging 0.72
R8690:Carm1 UTSW 9 21,480,808 (GRCm39) missense probably damaging 1.00
R8821:Carm1 UTSW 9 21,491,663 (GRCm39) missense probably damaging 1.00
R8831:Carm1 UTSW 9 21,491,663 (GRCm39) missense probably damaging 1.00
R8947:Carm1 UTSW 9 21,497,749 (GRCm39) missense probably damaging 1.00
R8950:Carm1 UTSW 9 21,490,789 (GRCm39) missense probably damaging 1.00
R9242:Carm1 UTSW 9 21,494,350 (GRCm39) missense probably damaging 1.00
R9399:Carm1 UTSW 9 21,486,791 (GRCm39) missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- GACAACAGTGTGGTGGTTGGCTCA -3'
(R):5'- CAGACAGGCTAATTCTCAGGACCCA -3'

Sequencing Primer
(F):5'- GGCTCATCTGTGGCCTC -3'
(R):5'- ACCCTAAGTGTACCTTTGTGG -3'
Posted On 2014-03-17