Incidental Mutation 'R1391:Magi3'
ID162599
Institutional Source Beutler Lab
Gene Symbol Magi3
Ensembl Gene ENSMUSG00000052539
Gene Namemembrane associated guanylate kinase, WW and PDZ domain containing 3
Synonyms4732496O19Rik, 6530407C02Rik
MMRRC Submission 039453-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.340) question?
Stock #R1391 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location104013259-104220374 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 104015058 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 1448 (K1448*)
Ref Sequence ENSEMBL: ENSMUSP00000112934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064371] [ENSMUST00000121198] [ENSMUST00000122303] [ENSMUST00000145727]
Predicted Effect probably benign
Transcript: ENSMUST00000064371
SMART Domains Protein: ENSMUSP00000067932
Gene: ENSMUSG00000052539

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Predicted Effect probably null
Transcript: ENSMUST00000121198
AA Change: K1448*
SMART Domains Protein: ENSMUSP00000112934
Gene: ENSMUSG00000052539
AA Change: K1448*

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122303
SMART Domains Protein: ENSMUSP00000113713
Gene: ENSMUSG00000052539

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145727
SMART Domains Protein: ENSMUSP00000114722
Gene: ENSMUSG00000058388

DomainStartEndE-ValueType
Pfam:Phtf-FEM1B_bdg 3 158 1.6e-88 PFAM
low complexity region 170 181 N/A INTRINSIC
low complexity region 347 370 N/A INTRINSIC
transmembrane domain 473 492 N/A INTRINSIC
transmembrane domain 512 534 N/A INTRINSIC
transmembrane domain 610 632 N/A INTRINSIC
transmembrane domain 647 664 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.4%
  • 20x: 86.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amer3 A T 1: 34,588,389 T570S probably benign Het
Ank3 A T 10: 69,534,280 K20I possibly damaging Het
Bmp10 G A 6: 87,433,758 E178K probably benign Het
Brca1 T A 11: 101,526,546 H254L possibly damaging Het
Cdon C T 9: 35,504,189 S1241L possibly damaging Het
Cnst C A 1: 179,579,486 P33T possibly damaging Het
Dnhd1 A G 7: 105,720,124 Y4318C probably damaging Het
Farp1 G A 14: 121,257,966 W611* probably null Het
Fst C T 13: 114,454,279 probably benign Het
Gapvd1 A G 2: 34,706,802 L714P probably damaging Het
Hectd4 T G 5: 121,353,695 L3732R possibly damaging Het
Lox A G 18: 52,528,819 Y171H probably damaging Het
Med12l T A 3: 59,037,738 I128N probably benign Het
Pkd1l2 T C 8: 117,054,934 T791A possibly damaging Het
Prrt4 A G 6: 29,169,951 V834A possibly damaging Het
Ptprz1 A G 6: 23,001,729 S1273G probably benign Het
Slc13a4 A C 6: 35,271,662 F517V probably damaging Het
Treh T C 9: 44,685,305 V452A probably benign Het
Vmn2r83 T A 10: 79,479,097 M393K probably damaging Het
Zfp931 T C 2: 178,068,191 N134S probably benign Het
Other mutations in Magi3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Magi3 APN 3 104014978 missense probably damaging 1.00
IGL00933:Magi3 APN 3 104015847 missense probably benign
IGL01151:Magi3 APN 3 104051374 missense probably damaging 1.00
IGL01674:Magi3 APN 3 104105721 splice site probably benign
IGL01790:Magi3 APN 3 104085244 missense probably damaging 1.00
IGL01903:Magi3 APN 3 104051210 missense possibly damaging 0.87
IGL01939:Magi3 APN 3 104054462 missense probably damaging 0.99
IGL02142:Magi3 APN 3 104015903 missense probably benign 0.32
IGL02183:Magi3 APN 3 104085347 missense probably benign 0.01
IGL02887:Magi3 APN 3 104095157 missense probably damaging 1.00
IGL03071:Magi3 APN 3 104015886 missense possibly damaging 0.51
IGL03085:Magi3 APN 3 104015339 missense possibly damaging 0.88
IGL03192:Magi3 APN 3 104043246 missense probably damaging 1.00
IGL03204:Magi3 APN 3 104105835 missense probably damaging 1.00
IGL03227:Magi3 APN 3 104051119 missense probably benign
IGL03388:Magi3 APN 3 104015841 missense probably benign 0.30
R0092:Magi3 UTSW 3 104050964 nonsense probably null
R0514:Magi3 UTSW 3 104015022 missense probably damaging 1.00
R0569:Magi3 UTSW 3 104016042 missense probably benign 0.43
R0608:Magi3 UTSW 3 104017557 missense probably damaging 1.00
R0920:Magi3 UTSW 3 104034191 splice site probably null
R1173:Magi3 UTSW 3 104061630 critical splice donor site probably null
R1256:Magi3 UTSW 3 104027810 missense probably benign 0.08
R1559:Magi3 UTSW 3 104046853 splice site probably benign
R1568:Magi3 UTSW 3 104089527 missense probably benign 0.02
R1631:Magi3 UTSW 3 104051177 missense probably benign 0.05
R1747:Magi3 UTSW 3 104034173 missense possibly damaging 0.82
R1930:Magi3 UTSW 3 104089604 missense probably damaging 1.00
R1964:Magi3 UTSW 3 104020402 missense probably damaging 0.99
R2151:Magi3 UTSW 3 104046882 missense probably damaging 1.00
R2151:Magi3 UTSW 3 104085238 missense probably damaging 1.00
R2266:Magi3 UTSW 3 104021066 intron probably benign
R2267:Magi3 UTSW 3 104021066 intron probably benign
R2268:Magi3 UTSW 3 104021066 intron probably benign
R2519:Magi3 UTSW 3 104015765 missense probably benign 0.00
R3104:Magi3 UTSW 3 104051320 missense probably damaging 0.99
R3105:Magi3 UTSW 3 104051320 missense probably damaging 0.99
R3619:Magi3 UTSW 3 104054405 missense probably damaging 1.00
R4158:Magi3 UTSW 3 104050961 missense probably damaging 1.00
R4160:Magi3 UTSW 3 104050961 missense probably damaging 1.00
R4284:Magi3 UTSW 3 104015868 nonsense probably null
R4285:Magi3 UTSW 3 104015868 nonsense probably null
R4397:Magi3 UTSW 3 104219714 missense probably damaging 1.00
R4512:Magi3 UTSW 3 104089555 missense probably damaging 0.99
R4676:Magi3 UTSW 3 104015825 missense probably benign
R4758:Magi3 UTSW 3 104015321 missense probably benign 0.01
R4940:Magi3 UTSW 3 104051392 missense probably damaging 1.00
R5039:Magi3 UTSW 3 104105791 missense probably damaging 1.00
R5160:Magi3 UTSW 3 104027908 missense possibly damaging 0.46
R5422:Magi3 UTSW 3 104051368 missense probably damaging 1.00
R5509:Magi3 UTSW 3 104015502 missense probably benign 0.00
R5839:Magi3 UTSW 3 104219731 missense probably damaging 1.00
R5924:Magi3 UTSW 3 104054538 splice site probably null
R6018:Magi3 UTSW 3 104105812 missense probably damaging 1.00
R6189:Magi3 UTSW 3 104050865 missense probably damaging 1.00
R6235:Magi3 UTSW 3 104016068 missense probably damaging 0.99
R6244:Magi3 UTSW 3 104015697 missense probably benign 0.16
R6258:Magi3 UTSW 3 104089596 missense probably damaging 1.00
R6358:Magi3 UTSW 3 104050952 missense probably damaging 1.00
R6534:Magi3 UTSW 3 104085220 missense possibly damaging 0.75
R6806:Magi3 UTSW 3 104046969 missense possibly damaging 0.94
R6816:Magi3 UTSW 3 104089911 intron probably null
R6897:Magi3 UTSW 3 104089557 missense probably damaging 1.00
X0026:Magi3 UTSW 3 104020420 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAGCCTGACGACTTGCTATTGAAG -3'
(R):5'- AGGAGGCAACAGCCTGTCAAAC -3'

Sequencing Primer
(F):5'- AATTTCTGGGGGAAAACCACAC -3'
(R):5'- ATCTGAAGCAGAGTCAGCC -3'
Posted On2014-03-17