Incidental Mutation 'R1396:Ints2'
ID162658
Institutional Source Beutler Lab
Gene Symbol Ints2
Ensembl Gene ENSMUSG00000018068
Gene Nameintegrator complex subunit 2
Synonyms2810417D08Rik
MMRRC Submission 039458-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R1396 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location86210681-86257575 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 86249248 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 253 (Q253K)
Ref Sequence ENSEMBL: ENSMUSP00000103674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039] [ENSMUST00000139285]
Predicted Effect probably damaging
Transcript: ENSMUST00000018212
AA Change: Q253K

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: Q253K

DomainStartEndE-ValueType
Pfam:INTS2 24 1131 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108039
AA Change: Q253K

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: Q253K

DomainStartEndE-ValueType
Pfam:INTS2 24 1132 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134883
Predicted Effect probably benign
Transcript: ENSMUST00000139285
SMART Domains Protein: ENSMUSP00000119084
Gene: ENSMUSG00000018068

DomainStartEndE-ValueType
Pfam:INTS2 24 190 1.4e-69 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143819
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik A G 14: 95,882,551 N248S probably benign Het
4930486L24Rik G A 13: 60,853,243 P160S probably benign Het
Adamts12 G T 15: 11,311,472 D1272Y probably benign Het
Akr1c20 A T 13: 4,507,727 V267D probably damaging Het
C1s1 A G 6: 124,531,051 S660P probably damaging Het
Ccdc40 A G 11: 119,231,803 T144A possibly damaging Het
Cdk20 T C 13: 64,437,403 I167T probably damaging Het
Chd6 A G 2: 160,983,103 L1212S probably damaging Het
Clock G C 5: 76,266,802 D15E probably benign Het
Clstn2 A G 9: 97,461,393 V667A probably benign Het
Cr2 A T 1: 195,169,253 probably null Het
Cyp2e1 A G 7: 140,773,079 D343G probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Etf1 G A 18: 34,908,167 T298I possibly damaging Het
Gm5431 T C 11: 48,895,434 probably benign Het
Gss G A 2: 155,567,721 T265I probably damaging Het
Heatr1 C T 13: 12,406,046 S406L possibly damaging Het
Hgsnat C A 8: 25,957,335 M310I possibly damaging Het
Inpp5b G A 4: 124,789,080 R598H probably damaging Het
Kng1 A G 16: 23,078,980 M377V probably benign Het
Krt72 C T 15: 101,786,005 probably null Het
Lemd2 G C 17: 27,190,732 R482G probably damaging Het
Lrpprc C T 17: 84,726,303 D1049N possibly damaging Het
Lrrc49 A T 9: 60,680,527 H117Q probably damaging Het
Mcm6 A T 1: 128,351,476 F191Y probably damaging Het
Mecom T C 3: 29,979,800 T252A possibly damaging Het
Mgat4e T C 1: 134,541,533 T258A probably benign Het
Mpeg1 A G 19: 12,462,804 N542S probably damaging Het
Nln C T 13: 104,061,753 V184I probably benign Het
Nova1 A C 12: 46,816,893 F91L unknown Het
Polk T C 13: 96,484,208 I516V probably benign Het
Ppig C T 2: 69,749,018 P357S unknown Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rasal2 A T 1: 157,164,666 H552Q probably damaging Het
Rnf41 G A 10: 128,435,571 E117K probably benign Het
Sbk3 A G 7: 4,967,453 Y306H possibly damaging Het
Senp1 A G 15: 98,076,554 S126P probably benign Het
Sfr1 A G 19: 47,733,690 K182E probably benign Het
Slc25a4 C A 8: 46,209,288 R111L probably damaging Het
Slc9c1 A T 16: 45,573,347 Y551F probably benign Het
Stard4 A T 18: 33,206,210 N80K probably damaging Het
Tbk1 G A 10: 121,571,916 T104M probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmem102 A T 11: 69,804,370 W259R probably damaging Het
Tnk1 A T 11: 69,853,136 C466S probably benign Het
Tspoap1 A C 11: 87,766,120 Q307P probably damaging Het
Ugt2b35 A G 5: 87,011,530 N528D possibly damaging Het
Usp6nl A G 2: 6,426,998 probably null Het
Vmn1r203 C T 13: 22,524,508 T153M probably benign Het
Vmn1r89 T A 7: 13,220,011 S157T probably damaging Het
Vmn2r103 A T 17: 19,792,968 Y117F probably benign Het
Vmn2r116 A C 17: 23,386,141 M143L probably benign Het
Vmn2r62 A T 7: 42,764,837 D727E probably damaging Het
Vps13c A G 9: 67,955,022 I2974V probably benign Het
Wrn C T 8: 33,268,819 G769D probably damaging Het
Zhx3 T A 2: 160,781,020 H409L possibly damaging Het
Other mutations in Ints2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Ints2 APN 11 86233135 missense probably damaging 1.00
IGL02490:Ints2 APN 11 86233183 missense possibly damaging 0.93
IGL02612:Ints2 APN 11 86215578 missense probably damaging 1.00
IGL03396:Ints2 APN 11 86213062 missense probably damaging 0.99
R0015:Ints2 UTSW 11 86249287 missense probably damaging 1.00
R0015:Ints2 UTSW 11 86249287 missense probably damaging 1.00
R0355:Ints2 UTSW 11 86234749 missense probably benign 0.00
R0389:Ints2 UTSW 11 86248851 missense probably damaging 1.00
R0631:Ints2 UTSW 11 86233196 missense probably benign 0.02
R0944:Ints2 UTSW 11 86244463 missense possibly damaging 0.85
R1268:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1269:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1270:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1474:Ints2 UTSW 11 86226781 missense probably damaging 0.97
R1503:Ints2 UTSW 11 86226781 missense probably damaging 0.97
R1840:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1987:Ints2 UTSW 11 86217800 missense probably benign 0.03
R1990:Ints2 UTSW 11 86248934 missense possibly damaging 0.58
R1991:Ints2 UTSW 11 86248934 missense possibly damaging 0.58
R3694:Ints2 UTSW 11 86243001 missense probably benign 0.41
R4056:Ints2 UTSW 11 86242952 missense probably damaging 1.00
R4057:Ints2 UTSW 11 86242952 missense probably damaging 1.00
R4569:Ints2 UTSW 11 86256198 missense probably damaging 1.00
R4585:Ints2 UTSW 11 86249275 missense probably damaging 1.00
R4586:Ints2 UTSW 11 86249275 missense probably damaging 1.00
R4806:Ints2 UTSW 11 86256209 missense probably benign 0.10
R4929:Ints2 UTSW 11 86212653 missense possibly damaging 0.56
R5031:Ints2 UTSW 11 86256200 missense probably damaging 1.00
R5064:Ints2 UTSW 11 86249274 missense probably damaging 1.00
R5270:Ints2 UTSW 11 86215795 missense probably damaging 1.00
R5621:Ints2 UTSW 11 86242947 missense probably benign 0.32
R5875:Ints2 UTSW 11 86238312 missense probably benign 0.04
R5908:Ints2 UTSW 11 86215545 critical splice donor site probably null
R5914:Ints2 UTSW 11 86222174 missense probably benign 0.03
R5941:Ints2 UTSW 11 86250972 missense probably benign 0.01
R5975:Ints2 UTSW 11 86226748 missense possibly damaging 0.72
R6003:Ints2 UTSW 11 86238468 missense probably damaging 1.00
R6091:Ints2 UTSW 11 86236603 missense probably damaging 0.96
R6209:Ints2 UTSW 11 86225058 missense probably damaging 1.00
R6567:Ints2 UTSW 11 86226661 missense probably benign 0.42
R6764:Ints2 UTSW 11 86212779 missense probably benign 0.00
R7033:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R7132:Ints2 UTSW 11 86217754 missense not run
Predicted Primers PCR Primer
(F):5'- CCTGGCAAGTGACATTCTTCCACC -3'
(R):5'- AAGTTCCCAGGGTCTGCCTTCTAC -3'

Sequencing Primer
(F):5'- TTTAATGCACCTCAAGTTCAGAG -3'
(R):5'- TGCCTTCTACACTGTTTAAGTTG -3'
Posted On2014-03-17