Incidental Mutation 'R1393:Gria2'
ID162692
Institutional Source Beutler Lab
Gene Symbol Gria2
Ensembl Gene ENSMUSG00000033981
Gene Nameglutamate receptor, ionotropic, AMPA2 (alpha 2)
SynonymsGlur2, Glur-2, GluR-B, GluA2, GluR2
MMRRC Submission 039455-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.350) question?
Stock #R1393 (G1)
Quality Score170
Status Not validated
Chromosome3
Chromosomal Location80681450-80802835 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80707098 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 545 (E545G)
Ref Sequence ENSEMBL: ENSMUSP00000141447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075316] [ENSMUST00000107745] [ENSMUST00000192463]
Predicted Effect probably damaging
Transcript: ENSMUST00000075316
AA Change: E545G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074787
Gene: ENSMUSG00000033981
AA Change: E545G

DomainStartEndE-ValueType
Pfam:ANF_receptor 49 379 2.7e-58 PFAM
PBPe 415 790 3.75e-132 SMART
Lig_chan-Glu_bd 425 490 2.96e-31 SMART
low complexity region 820 832 N/A INTRINSIC
low complexity region 853 865 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107745
AA Change: E545G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103374
Gene: ENSMUSG00000033981
AA Change: E545G

DomainStartEndE-ValueType
Pfam:ANF_receptor 47 379 4.8e-53 PFAM
PBPe 415 790 8.16e-133 SMART
Lig_chan-Glu_bd 425 490 2.96e-31 SMART
low complexity region 820 832 N/A INTRINSIC
low complexity region 853 865 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192463
AA Change: E545G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141447
Gene: ENSMUSG00000033981
AA Change: E545G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 47 379 1.7e-51 PFAM
PBPe 415 770 1.2e-105 SMART
Lig_chan-Glu_bd 425 490 2.2e-35 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193645
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194383
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195062
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.7%
Validation Efficiency
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to a family of glutamate receptors that are sensitive to alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate (AMPA), and function as ligand-activated cation channels. These channels are assembled from 4 related subunits, Gria1-4. The subunit encoded by this gene (Gria2) is subject to RNA editing (CAG->CGG; Q->R) within the second transmembrane domain, which is thought to render the channel impermeable to Ca(2+). Alternative splicing, resulting in transcript variants encoding different isoforms, (including the flip and flop isoforms that vary in their signal transduction properties), has been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit epilepsy, deficient dendritic architecture, altered exploratory behavior, impaired motor and learning performance, and increased mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 A G 16: 20,560,430 N682S probably benign Het
Acta2 G A 19: 34,241,792 R337C probably damaging Het
Anxa5 G A 3: 36,453,509 T194I probably damaging Het
Atf1 A G 15: 100,232,766 T6A possibly damaging Het
Atg4d T A 9: 21,270,833 Y317N probably damaging Het
Bcl6 A G 16: 23,977,566 V37A probably damaging Het
Bsn T C 9: 108,110,517 probably benign Het
Cd300ld2 G A 11: 115,012,578 probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Chad A T 11: 94,565,314 M73L probably benign Het
Copz1 A G 15: 103,294,744 N95S probably benign Het
Cwf19l2 T C 9: 3,456,818 V717A probably benign Het
Dock3 C T 9: 106,911,349 G140R probably damaging Het
Gm14226 A T 2: 155,024,191 S23C probably damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr811 A G 10: 129,801,932 F198L probably benign Het
Patj G A 4: 98,424,411 V329I probably benign Het
Ptcd3 T A 6: 71,889,621 T404S probably benign Het
Rasa1 A G 13: 85,223,522 C867R probably damaging Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Rsad2 T C 12: 26,456,377 S15G probably damaging Het
Serpina12 T C 12: 104,037,750 I208V possibly damaging Het
Spock1 A T 13: 57,907,454 L45Q probably damaging Het
Stat3 A T 11: 100,888,765 probably null Het
Zfp810 T C 9: 22,280,514 D90G probably benign Het
Other mutations in Gria2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00796:Gria2 APN 3 80710790 missense probably benign 0.12
IGL00832:Gria2 APN 3 80707251 missense probably damaging 1.00
IGL01086:Gria2 APN 3 80692381 missense probably damaging 1.00
IGL01409:Gria2 APN 3 80707697 critical splice donor site probably null
IGL01924:Gria2 APN 3 80710331 missense probably benign 0.13
IGL01999:Gria2 APN 3 80732091 missense probably damaging 1.00
IGL02355:Gria2 APN 3 80706937 missense probably damaging 1.00
IGL02362:Gria2 APN 3 80706937 missense probably damaging 1.00
IGL02389:Gria2 APN 3 80709422 missense probably benign 0.14
IGL02444:Gria2 APN 3 80702553 missense possibly damaging 0.65
IGL02532:Gria2 APN 3 80706999 missense probably damaging 1.00
IGL02991:Gria2 UTSW 3 80707809 nonsense probably null
R0015:Gria2 UTSW 3 80707767 missense probably damaging 1.00
R0148:Gria2 UTSW 3 80707731 missense probably damaging 1.00
R0201:Gria2 UTSW 3 80707838 missense probably damaging 1.00
R0411:Gria2 UTSW 3 80710858 splice site probably benign
R0551:Gria2 UTSW 3 80732026 splice site probably benign
R0655:Gria2 UTSW 3 80732070 nonsense probably null
R0866:Gria2 UTSW 3 80722024 splice site probably benign
R1458:Gria2 UTSW 3 80732045 missense possibly damaging 0.71
R1563:Gria2 UTSW 3 80691397 missense probably damaging 0.96
R1771:Gria2 UTSW 3 80692301 nonsense probably null
R1775:Gria2 UTSW 3 80691338 missense probably benign 0.09
R1902:Gria2 UTSW 3 80722108 missense probably damaging 0.98
R1993:Gria2 UTSW 3 80802357 missense probably benign
R1994:Gria2 UTSW 3 80802357 missense probably benign
R1995:Gria2 UTSW 3 80802357 missense probably benign
R2001:Gria2 UTSW 3 80710805 missense probably benign 0.28
R2389:Gria2 UTSW 3 80702625 missense probably damaging 1.00
R2520:Gria2 UTSW 3 80706962 missense probably damaging 1.00
R2679:Gria2 UTSW 3 80740953 splice site probably benign
R2865:Gria2 UTSW 3 80732085 missense probably benign 0.00
R2869:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2869:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2870:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2870:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2871:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2871:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2872:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2872:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R3716:Gria2 UTSW 3 80741004 missense possibly damaging 0.77
R3967:Gria2 UTSW 3 80710777 missense possibly damaging 0.95
R4285:Gria2 UTSW 3 80707662 intron probably benign
R4611:Gria2 UTSW 3 80692492 missense probably damaging 0.99
R4612:Gria2 UTSW 3 80732051 missense probably damaging 1.00
R4616:Gria2 UTSW 3 80706897 missense probably damaging 1.00
R4706:Gria2 UTSW 3 80740990 missense probably benign
R4996:Gria2 UTSW 3 80707141 missense probably damaging 0.99
R5502:Gria2 UTSW 3 80706945 missense probably damaging 1.00
R5930:Gria2 UTSW 3 80707249 missense possibly damaging 0.91
R6142:Gria2 UTSW 3 80801717 missense probably benign 0.13
R6233:Gria2 UTSW 3 80707203 missense probably damaging 0.99
R6317:Gria2 UTSW 3 80741004 missense possibly damaging 0.79
R6453:Gria2 UTSW 3 80740974 missense possibly damaging 0.93
R6526:Gria2 UTSW 3 80692469 missense probably damaging 1.00
R6545:Gria2 UTSW 3 80741144 missense probably damaging 0.99
R6574:Gria2 UTSW 3 80689296 missense probably damaging 0.99
R6720:Gria2 UTSW 3 80802304 missense probably benign 0.37
R7009:Gria2 UTSW 3 80706972 missense probably damaging 1.00
R7049:Gria2 UTSW 3 80689327 missense probably damaging 0.99
R7191:Gria2 UTSW 3 80732085 missense probably benign 0.24
R7225:Gria2 UTSW 3 80802631 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCCTTGCTGCATAAAGGCACCC -3'
(R):5'- CCTTGGACAAGTCAGATAGGCCAAC -3'

Sequencing Primer
(F):5'- GGCACCCAAGGAAAACCAG -3'
(R):5'- GTCAGATAGGCCAACTATTCGTC -3'
Posted On2014-03-17