Incidental Mutation 'R1393:Ptcd3'
ID162695
Institutional Source Beutler Lab
Gene Symbol Ptcd3
Ensembl Gene ENSMUSG00000063884
Gene Namepentatricopeptide repeat domain 3
Synonyms2610034F17Rik, 2810422B04Rik
MMRRC Submission 039455-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1393 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location71880638-71908750 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 71889621 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 404 (T404S)
Ref Sequence ENSEMBL: ENSMUSP00000080743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082094] [ENSMUST00000206879]
Predicted Effect probably benign
Transcript: ENSMUST00000082094
AA Change: T404S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000080743
Gene: ENSMUSG00000063884
AA Change: T404S

DomainStartEndE-ValueType
low complexity region 2 8 N/A INTRINSIC
low complexity region 216 227 N/A INTRINSIC
Pfam:PPR_2 253 300 1.4e-10 PFAM
Pfam:PPR_3 331 366 2.1e-4 PFAM
low complexity region 671 684 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205691
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205761
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206762
Predicted Effect probably benign
Transcript: ENSMUST00000206879
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 A G 16: 20,560,430 N682S probably benign Het
Acta2 G A 19: 34,241,792 R337C probably damaging Het
Anxa5 G A 3: 36,453,509 T194I probably damaging Het
Atf1 A G 15: 100,232,766 T6A possibly damaging Het
Atg4d T A 9: 21,270,833 Y317N probably damaging Het
Bcl6 A G 16: 23,977,566 V37A probably damaging Het
Bsn T C 9: 108,110,517 probably benign Het
Cd300ld2 G A 11: 115,012,578 probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Chad A T 11: 94,565,314 M73L probably benign Het
Copz1 A G 15: 103,294,744 N95S probably benign Het
Cwf19l2 T C 9: 3,456,818 V717A probably benign Het
Dock3 C T 9: 106,911,349 G140R probably damaging Het
Gm14226 A T 2: 155,024,191 S23C probably damaging Het
Gria2 T C 3: 80,707,098 E545G probably damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr811 A G 10: 129,801,932 F198L probably benign Het
Patj G A 4: 98,424,411 V329I probably benign Het
Rasa1 A G 13: 85,223,522 C867R probably damaging Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Rsad2 T C 12: 26,456,377 S15G probably damaging Het
Serpina12 T C 12: 104,037,750 I208V possibly damaging Het
Spock1 A T 13: 57,907,454 L45Q probably damaging Het
Stat3 A T 11: 100,888,765 probably null Het
Zfp810 T C 9: 22,280,514 D90G probably benign Het
Other mutations in Ptcd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00767:Ptcd3 APN 6 71903448 missense probably damaging 0.96
IGL00903:Ptcd3 APN 6 71907844 missense possibly damaging 0.93
IGL01545:Ptcd3 APN 6 71888577 missense probably benign 0.01
IGL01924:Ptcd3 APN 6 71898427 missense probably damaging 1.00
IGL02675:Ptcd3 APN 6 71883442 critical splice donor site probably null
R0732:Ptcd3 UTSW 6 71881171 unclassified probably benign
R1374:Ptcd3 UTSW 6 71908653 nonsense probably null
R1498:Ptcd3 UTSW 6 71893495 missense probably damaging 1.00
R1646:Ptcd3 UTSW 6 71898395 missense probably benign 0.26
R1712:Ptcd3 UTSW 6 71908653 nonsense probably null
R2022:Ptcd3 UTSW 6 71885553 missense probably damaging 1.00
R2248:Ptcd3 UTSW 6 71894285 critical splice donor site probably null
R2406:Ptcd3 UTSW 6 71888647 missense probably damaging 1.00
R3418:Ptcd3 UTSW 6 71883486 missense possibly damaging 0.93
R3419:Ptcd3 UTSW 6 71883486 missense possibly damaging 0.93
R4677:Ptcd3 UTSW 6 71893514 missense probably benign 0.17
R4741:Ptcd3 UTSW 6 71902949 missense probably damaging 1.00
R4752:Ptcd3 UTSW 6 71901312 missense probably damaging 0.99
R5441:Ptcd3 UTSW 6 71881521 missense possibly damaging 0.62
R5583:Ptcd3 UTSW 6 71902936 missense probably damaging 1.00
R5681:Ptcd3 UTSW 6 71907659 missense probably damaging 1.00
R6028:Ptcd3 UTSW 6 71898408 missense probably damaging 1.00
R6324:Ptcd3 UTSW 6 71885327 missense probably benign 0.00
R6537:Ptcd3 UTSW 6 71897110 splice site probably null
R6600:Ptcd3 UTSW 6 71883546 missense probably damaging 1.00
R6783:Ptcd3 UTSW 6 71908643 missense probably benign 0.00
R6810:Ptcd3 UTSW 6 71885532 missense probably damaging 0.99
R6860:Ptcd3 UTSW 6 71897110 splice site probably null
R6993:Ptcd3 UTSW 6 71885315 missense probably damaging 1.00
X0024:Ptcd3 UTSW 6 71901274 missense probably damaging 1.00
X0065:Ptcd3 UTSW 6 71907806 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTGGTACTCACCACACTCATGGC -3'
(R):5'- GCTTAACCCAAGGATGGATGGATGG -3'

Sequencing Primer
(F):5'- CACAAAAAGTTTGGTTGGTGTAG -3'
(R):5'- gatggatggatggatggatggG -3'
Posted On2014-03-17