Incidental Mutation 'R1393:Rsad2'
List |< first << previous [record 22 of 26] next >> last >|
ID162708
Institutional Source Beutler Lab
Gene Symbol Rsad2
Ensembl Gene ENSMUSG00000020641
Gene Nameradical S-adenosyl methionine domain containing 2
Synonymsviperin, cig5, Vig1, 2510004L01Rik
MMRRC Submission 039455-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1393 (G1)
Quality Score205
Status Not validated
Chromosome12
Chromosomal Location26442746-26456452 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26456377 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 15 (S15G)
Ref Sequence ENSEMBL: ENSMUSP00000121791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020970] [ENSMUST00000137792]
Predicted Effect probably benign
Transcript: ENSMUST00000020970
AA Change: S15G

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000020970
Gene: ENSMUSG00000020641
AA Change: S15G

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
Elp3 74 282 8.55e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000137792
AA Change: S15G

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121791
Gene: ENSMUSG00000020641
AA Change: S15G

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
Pfam:Fer4_12 69 174 1.3e-10 PFAM
Pfam:Fer4_14 78 172 7.7e-11 PFAM
Pfam:Radical_SAM 78 178 9.5e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142732
Meta Mutation Damage Score 0.008 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit impaired T-helper 2 differentitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 A G 16: 20,560,430 N682S probably benign Het
Acta2 G A 19: 34,241,792 R337C probably damaging Het
Anxa5 G A 3: 36,453,509 T194I probably damaging Het
Atf1 A G 15: 100,232,766 T6A possibly damaging Het
Atg4d T A 9: 21,270,833 Y317N probably damaging Het
Bcl6 A G 16: 23,977,566 V37A probably damaging Het
Bsn T C 9: 108,110,517 probably benign Het
Cd300ld2 G A 11: 115,012,578 probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Chad A T 11: 94,565,314 M73L probably benign Het
Copz1 A G 15: 103,294,744 N95S probably benign Het
Cwf19l2 T C 9: 3,456,818 V717A probably benign Het
Dock3 C T 9: 106,911,349 G140R probably damaging Het
Gm14226 A T 2: 155,024,191 S23C probably damaging Het
Gria2 T C 3: 80,707,098 E545G probably damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr811 A G 10: 129,801,932 F198L probably benign Het
Patj G A 4: 98,424,411 V329I probably benign Het
Ptcd3 T A 6: 71,889,621 T404S probably benign Het
Rasa1 A G 13: 85,223,522 C867R probably damaging Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Serpina12 T C 12: 104,037,750 I208V possibly damaging Het
Spock1 A T 13: 57,907,454 L45Q probably damaging Het
Stat3 A T 11: 100,888,765 probably null Het
Zfp810 T C 9: 22,280,514 D90G probably benign Het
Other mutations in Rsad2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01431:Rsad2 APN 12 26448667 missense probably benign 0.01
IGL02237:Rsad2 APN 12 26456187 missense probably damaging 1.00
R0077:Rsad2 UTSW 12 26456377 missense probably damaging 0.96
R0472:Rsad2 UTSW 12 26454168 missense possibly damaging 0.87
R1368:Rsad2 UTSW 12 26447148 splice site probably null
R1392:Rsad2 UTSW 12 26445440 missense probably benign 0.00
R1392:Rsad2 UTSW 12 26445440 missense probably benign 0.00
R1860:Rsad2 UTSW 12 26450617 missense probably damaging 1.00
R2286:Rsad2 UTSW 12 26450676 missense probably benign 0.20
R3430:Rsad2 UTSW 12 26456419 start codon destroyed probably null 0.98
R5304:Rsad2 UTSW 12 26450682 missense probably damaging 1.00
R6000:Rsad2 UTSW 12 26447151 critical splice donor site probably null
R6052:Rsad2 UTSW 12 26450578 missense probably benign 0.02
R6084:Rsad2 UTSW 12 26454123 missense probably damaging 1.00
R6193:Rsad2 UTSW 12 26456187 missense probably damaging 1.00
R7019:Rsad2 UTSW 12 26456419 start codon destroyed possibly damaging 0.89
R7158:Rsad2 UTSW 12 26450780 splice site probably null
R7229:Rsad2 UTSW 12 26454123 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGAAGTGGTAGTTGACACTCACGG -3'
(R):5'- AAGGTTCAGTCTTGGCTCTGGTCC -3'

Sequencing Primer
(F):5'- TGACACTCACGGGGGTTG -3'
(R):5'- GGTCCAACTTTCATTTTCAGAAAAC -3'
Posted On2014-03-17