Incidental Mutation 'R1393:Serpina12'
List |< first << previous [record 23 of 26] next >> last >|
ID162710
Institutional Source Beutler Lab
Gene Symbol Serpina12
Ensembl Gene ENSMUSG00000041567
Gene Nameserine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12
Synonymsvaspin
MMRRC Submission 039455-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1393 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location104028769-104044443 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104037750 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 208 (I208V)
Ref Sequence ENSEMBL: ENSMUSP00000045572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043915]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043915
AA Change: I208V

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000045572
Gene: ENSMUSG00000041567
AA Change: I208V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SERPIN 57 411 1.02e-139 SMART
Meta Mutation Damage Score 0.008 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice hmomozygous for a knock-out allele exhibit increased body weight, epididymal fat pad weight, liver weight, fat cell size, serum total and small density LDL cholesterol, serum leptin, liver triglyceride and insulin resistance when fed a high fat, high sucrose diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 A G 16: 20,560,430 N682S probably benign Het
Acta2 G A 19: 34,241,792 R337C probably damaging Het
Anxa5 G A 3: 36,453,509 T194I probably damaging Het
Atf1 A G 15: 100,232,766 T6A possibly damaging Het
Atg4d T A 9: 21,270,833 Y317N probably damaging Het
Bcl6 A G 16: 23,977,566 V37A probably damaging Het
Bsn T C 9: 108,110,517 probably benign Het
Cd300ld2 G A 11: 115,012,578 probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Chad A T 11: 94,565,314 M73L probably benign Het
Copz1 A G 15: 103,294,744 N95S probably benign Het
Cwf19l2 T C 9: 3,456,818 V717A probably benign Het
Dock3 C T 9: 106,911,349 G140R probably damaging Het
Gm14226 A T 2: 155,024,191 S23C probably damaging Het
Gria2 T C 3: 80,707,098 E545G probably damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr811 A G 10: 129,801,932 F198L probably benign Het
Patj G A 4: 98,424,411 V329I probably benign Het
Ptcd3 T A 6: 71,889,621 T404S probably benign Het
Rasa1 A G 13: 85,223,522 C867R probably damaging Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Rsad2 T C 12: 26,456,377 S15G probably damaging Het
Spock1 A T 13: 57,907,454 L45Q probably damaging Het
Stat3 A T 11: 100,888,765 probably null Het
Zfp810 T C 9: 22,280,514 D90G probably benign Het
Other mutations in Serpina12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00598:Serpina12 APN 12 104031114 missense probably benign 0.01
IGL00976:Serpina12 APN 12 104032528 missense probably damaging 1.00
IGL01592:Serpina12 APN 12 104038122 missense probably damaging 1.00
IGL02355:Serpina12 APN 12 104037881 missense probably benign 0.00
IGL02362:Serpina12 APN 12 104037881 missense probably benign 0.00
IGL02648:Serpina12 APN 12 104038008 missense probably benign 0.02
IGL03011:Serpina12 APN 12 104031138 missense possibly damaging 0.86
IGL03156:Serpina12 APN 12 104037899 missense probably damaging 1.00
sabina UTSW 12 104037920 missense probably damaging 1.00
PIT4305001:Serpina12 UTSW 12 104035717 missense probably damaging 1.00
R0038:Serpina12 UTSW 12 104037957 missense probably damaging 1.00
R0038:Serpina12 UTSW 12 104037957 missense probably damaging 1.00
R0448:Serpina12 UTSW 12 104038095 missense probably benign 0.20
R0465:Serpina12 UTSW 12 104037845 missense probably benign 0.04
R0480:Serpina12 UTSW 12 104035701 missense probably damaging 1.00
R0498:Serpina12 UTSW 12 104035789 missense probably damaging 1.00
R0503:Serpina12 UTSW 12 104031159 missense probably damaging 0.97
R0581:Serpina12 UTSW 12 104031140 missense probably damaging 0.97
R1847:Serpina12 UTSW 12 104032510 missense probably damaging 1.00
R1956:Serpina12 UTSW 12 104035789 missense probably damaging 1.00
R3125:Serpina12 UTSW 12 104037983 missense probably benign
R4093:Serpina12 UTSW 12 104037924 missense probably damaging 1.00
R4584:Serpina12 UTSW 12 104038352 missense unknown
R4897:Serpina12 UTSW 12 104037797 missense possibly damaging 0.60
R5117:Serpina12 UTSW 12 104037750 missense possibly damaging 0.73
R5167:Serpina12 UTSW 12 104037920 missense probably damaging 1.00
R5344:Serpina12 UTSW 12 104035548 splice site probably null
R5720:Serpina12 UTSW 12 104038304 missense probably benign 0.05
R6011:Serpina12 UTSW 12 104035734 missense probably damaging 1.00
R6027:Serpina12 UTSW 12 104031077 missense probably benign 0.01
R6170:Serpina12 UTSW 12 104038241 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTTAGACCTTGGAGTAACCCTCCCC -3'
(R):5'- ATGCGGACATGGTGCTCACTAAC -3'

Sequencing Primer
(F):5'- CTCTCTTATCTAGGAAGCAGAGAC -3'
(R):5'- GGTGCTCACTAACTTCCAGGAC -3'
Posted On2014-03-17