Incidental Mutation 'R1393:Rps24'
List |< first << previous [record 21 of 26] next >> last >|
ID162713
Institutional Source Beutler Lab
Gene Symbol Rps24
Ensembl Gene ENSMUSG00000025290
Gene Nameribosomal protein S24
SynonymsMRP S24
MMRRC Submission 039455-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.783) question?
Stock #R1393 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location24487125-24496959 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24491762 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 6 (T6A)
Ref Sequence ENSEMBL: ENSMUSP00000152944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026322] [ENSMUST00000112384] [ENSMUST00000169826] [ENSMUST00000223718] [ENSMUST00000223999] [ENSMUST00000224568] [ENSMUST00000225023]
Predicted Effect probably benign
Transcript: ENSMUST00000026322
SMART Domains Protein: ENSMUSP00000026322
Gene: ENSMUSG00000025280

DomainStartEndE-ValueType
Blast:RPOLA_N 122 218 5e-43 BLAST
RPOLA_N 248 553 1.09e-176 SMART
Pfam:RNA_pol_Rpb1_4 728 834 4e-35 PFAM
Pfam:RNA_pol_Rpb1_5 841 1318 1.2e-92 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112384
AA Change: T6A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108003
Gene: ENSMUSG00000025290
AA Change: T6A

DomainStartEndE-ValueType
Pfam:Ribosomal_S24e 23 108 4.4e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169826
AA Change: T6A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125977
Gene: ENSMUSG00000025290
AA Change: T6A

DomainStartEndE-ValueType
Pfam:Ribosomal_S24e 24 102 1.9e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223931
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223939
Predicted Effect probably damaging
Transcript: ENSMUST00000223999
AA Change: T6A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224549
Predicted Effect probably benign
Transcript: ENSMUST00000224568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225014
Predicted Effect probably damaging
Transcript: ENSMUST00000225023
AA Change: T6A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225994
Meta Mutation Damage Score 0.222 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S24E family of ribosomal proteins. It is located in the cytoplasm. Multiple transcript variants encoding different isoforms have been found for this gene. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Mutations in this gene result in Diamond-Blackfan anemia. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 A G 16: 20,560,430 N682S probably benign Het
Acta2 G A 19: 34,241,792 R337C probably damaging Het
Anxa5 G A 3: 36,453,509 T194I probably damaging Het
Atf1 A G 15: 100,232,766 T6A possibly damaging Het
Atg4d T A 9: 21,270,833 Y317N probably damaging Het
Bcl6 A G 16: 23,977,566 V37A probably damaging Het
Bsn T C 9: 108,110,517 probably benign Het
Cd300ld2 G A 11: 115,012,578 probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Chad A T 11: 94,565,314 M73L probably benign Het
Copz1 A G 15: 103,294,744 N95S probably benign Het
Cwf19l2 T C 9: 3,456,818 V717A probably benign Het
Dock3 C T 9: 106,911,349 G140R probably damaging Het
Gm14226 A T 2: 155,024,191 S23C probably damaging Het
Gria2 T C 3: 80,707,098 E545G probably damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr811 A G 10: 129,801,932 F198L probably benign Het
Patj G A 4: 98,424,411 V329I probably benign Het
Ptcd3 T A 6: 71,889,621 T404S probably benign Het
Rasa1 A G 13: 85,223,522 C867R probably damaging Het
Rsad2 T C 12: 26,456,377 S15G probably damaging Het
Serpina12 T C 12: 104,037,750 I208V possibly damaging Het
Spock1 A T 13: 57,907,454 L45Q probably damaging Het
Stat3 A T 11: 100,888,765 probably null Het
Zfp810 T C 9: 22,280,514 D90G probably benign Het
Other mutations in Rps24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02049:Rps24 APN 14 24491755 missense probably benign
R1209:Rps24 UTSW 14 24491762 missense probably damaging 1.00
R1317:Rps24 UTSW 14 24491762 missense probably damaging 1.00
R1363:Rps24 UTSW 14 24491762 missense probably damaging 1.00
R1365:Rps24 UTSW 14 24491762 missense probably damaging 1.00
R1427:Rps24 UTSW 14 24491762 missense probably damaging 1.00
R1429:Rps24 UTSW 14 24491762 missense probably damaging 1.00
R1771:Rps24 UTSW 14 24491762 missense probably damaging 1.00
R1776:Rps24 UTSW 14 24491762 missense probably damaging 1.00
R2916:Rps24 UTSW 14 24491941 missense probably benign 0.02
R4837:Rps24 UTSW 14 24491787 missense possibly damaging 0.93
R6146:Rps24 UTSW 14 24490735 start gained probably null
R6249:Rps24 UTSW 14 24493462 missense possibly damaging 0.92
R6386:Rps24 UTSW 14 24492048 missense possibly damaging 0.79
R7316:Rps24 UTSW 14 24490689 unclassified probably benign
V7732:Rps24 UTSW 14 24491762 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCTCGCTGAATGCCAGCTAC -3'
(R):5'- CCCAGGATGAAGGACATCAATGACC -3'

Sequencing Primer
(F):5'- TCTCCAAGCACTAGAGGCATTG -3'
(R):5'- TGACCTATAAAGAGGTGTAAGAGTC -3'
Posted On2014-03-17