Incidental Mutation 'R1393:Atf1'
List |< first << previous [record 4 of 26] next >> last >|
ID162714
Institutional Source Beutler Lab
Gene Symbol Atf1
Ensembl Gene ENSMUSG00000023027
Gene Nameactivating transcription factor 1
Synonyms
MMRRC Submission 039455-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1393 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location100227819-100261244 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100232766 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 6 (T6A)
Ref Sequence ENSEMBL: ENSMUSP00000155718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023769] [ENSMUST00000163855] [ENSMUST00000165804] [ENSMUST00000168103] [ENSMUST00000169408] [ENSMUST00000171869] [ENSMUST00000172154]
Predicted Effect probably benign
Transcript: ENSMUST00000023769
AA Change: T10A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023769
Gene: ENSMUSG00000023027
AA Change: T10A

DomainStartEndE-ValueType
Pfam:pKID 43 83 3.9e-21 PFAM
BRLZ 209 266 3.28e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163855
Predicted Effect probably benign
Transcript: ENSMUST00000165804
AA Change: T13A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127969
Gene: ENSMUSG00000023027
AA Change: T13A

DomainStartEndE-ValueType
Pfam:pKID 46 76 1.9e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166809
Predicted Effect possibly damaging
Transcript: ENSMUST00000168103
AA Change: T6A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000169408
AA Change: T10A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000171869
AA Change: T10A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131278
Gene: ENSMUSG00000023027
AA Change: T10A

DomainStartEndE-ValueType
Pfam:pKID 43 67 5.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172154
AA Change: T10A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132907
Gene: ENSMUSG00000023027
AA Change: T10A

DomainStartEndE-ValueType
Pfam:pKID 43 83 2.5e-20 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene does not result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 A G 16: 20,560,430 N682S probably benign Het
Acta2 G A 19: 34,241,792 R337C probably damaging Het
Anxa5 G A 3: 36,453,509 T194I probably damaging Het
Atg4d T A 9: 21,270,833 Y317N probably damaging Het
Bcl6 A G 16: 23,977,566 V37A probably damaging Het
Bsn T C 9: 108,110,517 probably benign Het
Cd300ld2 G A 11: 115,012,578 probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Chad A T 11: 94,565,314 M73L probably benign Het
Copz1 A G 15: 103,294,744 N95S probably benign Het
Cwf19l2 T C 9: 3,456,818 V717A probably benign Het
Dock3 C T 9: 106,911,349 G140R probably damaging Het
Gm14226 A T 2: 155,024,191 S23C probably damaging Het
Gria2 T C 3: 80,707,098 E545G probably damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr811 A G 10: 129,801,932 F198L probably benign Het
Patj G A 4: 98,424,411 V329I probably benign Het
Ptcd3 T A 6: 71,889,621 T404S probably benign Het
Rasa1 A G 13: 85,223,522 C867R probably damaging Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Rsad2 T C 12: 26,456,377 S15G probably damaging Het
Serpina12 T C 12: 104,037,750 I208V possibly damaging Het
Spock1 A T 13: 57,907,454 L45Q probably damaging Het
Stat3 A T 11: 100,888,765 probably null Het
Zfp810 T C 9: 22,280,514 D90G probably benign Het
Other mutations in Atf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01807:Atf1 APN 15 100252064 splice site probably benign
IGL02172:Atf1 APN 15 100254441 missense probably damaging 0.99
IGL02718:Atf1 APN 15 100254219 missense probably damaging 1.00
R0426:Atf1 UTSW 15 100232827 missense possibly damaging 0.66
R1965:Atf1 UTSW 15 100254171 missense probably benign 0.12
R1968:Atf1 UTSW 15 100254514 critical splice donor site probably null
R4913:Atf1 UTSW 15 100252098 unclassified probably null
R5837:Atf1 UTSW 15 100254384 missense probably damaging 1.00
R6064:Atf1 UTSW 15 100252148 missense probably benign 0.24
R6230:Atf1 UTSW 15 100232824 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TCACGTTCTGTAGCAACTGGCATC -3'
(R):5'- CAAGTCTGATAAGCCCTAACGCCTG -3'

Sequencing Primer
(F):5'- catggctgtcctggaactc -3'
(R):5'- GCCAGAAGTTGCCCCATAATTTTAG -3'
Posted On2014-03-17