Incidental Mutation 'R1395:Tgm2'
ID162786
Institutional Source Beutler Lab
Gene Symbol Tgm2
Ensembl Gene ENSMUSG00000037820
Gene Nametransglutaminase 2, C polypeptide
SynonymstTG, protein-glutamine gamma-glutamyltransferase, TGase2, TG2, TG C, G[a]h, tTGas, tissue transglutaminase
MMRRC Submission 039457-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R1395 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location158116402-158146436 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 158124252 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 494 (H494L)
Ref Sequence ENSEMBL: ENSMUSP00000099411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103122] [ENSMUST00000152452] [ENSMUST00000174718]
Predicted Effect probably benign
Transcript: ENSMUST00000103122
AA Change: H494L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000099411
Gene: ENSMUSG00000037820
AA Change: H494L

DomainStartEndE-ValueType
Pfam:Transglut_N 6 122 3.6e-34 PFAM
TGc 269 361 1.11e-38 SMART
Pfam:Transglut_C 473 572 5.7e-29 PFAM
Pfam:Transglut_C 586 685 2.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152452
SMART Domains Protein: ENSMUSP00000118434
Gene: ENSMUSG00000027651

DomainStartEndE-ValueType
RPR 8 130 1.71e-53 SMART
low complexity region 132 145 N/A INTRINSIC
PDB:4FLA|D 171 222 3e-25 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000174718
SMART Domains Protein: ENSMUSP00000133662
Gene: ENSMUSG00000037820

DomainStartEndE-ValueType
Pfam:Transglut_N 5 124 1.9e-37 PFAM
Meta Mutation Damage Score 0.024 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transglutaminases are enzymes that catalyze the crosslinking of proteins by epsilon-gamma glutamyl lysine isopeptide bonds. While the primary structure of transglutaminases is not conserved, they all have the same amino acid sequence at their active sites and their activity is calcium-dependent. The protein encoded by this gene acts as a monomer, is induced by retinoic acid, and appears to be involved in apoptosis. Finally, the encoded protein is the autoantigen implicated in celiac disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: A homozygous null mutation causes alterations in glucose and aerobic energy metabolism, tumor growth, and response to myocardial infarction, liver injury, and LPS-induced sepsis. A second null mutation confers resistance to renal injury, while a third one alters cell adhesion and T cell physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A G 5: 113,101,496 Y122H probably damaging Het
4932431P20Rik T A 7: 29,531,387 noncoding transcript Het
A330070K13Rik A G 5: 130,379,141 probably benign Het
Abcc2 A G 19: 43,833,940 R1406G probably benign Het
Adgrv1 G T 13: 81,386,788 T5786K probably benign Het
Ankrd27 T C 7: 35,615,869 F481S possibly damaging Het
Arhgap11a C T 2: 113,833,122 V939I probably benign Het
Arhgap12 T C 18: 6,037,058 N561S probably benign Het
Arhgef12 T C 9: 43,005,870 H391R probably damaging Het
Asb3 T C 11: 31,101,032 probably benign Het
C2cd5 T C 6: 143,061,738 probably benign Het
Ccdc85a T C 11: 28,583,412 K44R possibly damaging Het
Cep128 C T 12: 91,266,980 R438Q probably benign Het
Cep192 A G 18: 67,858,921 T1957A probably damaging Het
Col20a1 T A 2: 180,998,607 V519E probably damaging Het
Cylc2 A G 4: 51,228,366 K146E possibly damaging Het
Dst T C 1: 34,165,155 probably null Het
Eef1a1 C T 9: 78,479,018 V402I probably benign Het
Esyt3 T C 9: 99,316,782 probably benign Het
Extl3 A G 14: 65,077,496 V79A possibly damaging Het
Fat3 C T 9: 16,246,916 V1133I probably benign Het
Fcgbp A G 7: 28,093,379 H936R probably damaging Het
Fdxacb1 TAGAC T 9: 50,772,496 probably null Het
Fryl T C 5: 73,072,912 H1634R probably damaging Het
Gm44511 G A 6: 128,820,330 S32L possibly damaging Het
Gm597 T C 1: 28,776,809 E714G possibly damaging Het
Gm8374 G T 14: 7,364,174 N55K probably benign Het
Gria1 T A 11: 57,283,566 I558N probably damaging Het
Gse1 G T 8: 120,574,999 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hectd4 T C 5: 121,328,513 probably null Het
Herc1 T C 9: 66,439,181 I1943T probably benign Het
Ift172 T C 5: 31,285,238 probably benign Het
Ift81 G T 5: 122,568,923 D485E probably benign Het
Lactb T C 9: 66,971,379 probably benign Het
Map1a C T 2: 121,303,925 H1741Y probably benign Het
Map1lc3b T C 8: 121,596,720 Y110H probably benign Het
Mlh1 T C 9: 111,247,377 D304G probably damaging Het
Myo1f A G 17: 33,583,740 D386G probably damaging Het
Ncoa4 T A 14: 32,172,841 probably null Het
Neto1 T C 18: 86,398,019 probably benign Het
Nf1 T C 11: 79,535,983 V1741A possibly damaging Het
Nkain2 C A 10: 32,890,189 probably benign Het
Obsl1 T C 1: 75,492,665 S109G probably damaging Het
Olfr12 T A 1: 92,620,545 I213N probably benign Het
Olfr1347 T A 7: 6,488,362 T171S probably damaging Het
Olfr564 G A 7: 102,804,207 C243Y possibly damaging Het
Olfr615 T C 7: 103,561,119 L214P possibly damaging Het
Phlpp1 T C 1: 106,350,618 V920A possibly damaging Het
Prrxl1 C T 14: 32,608,369 P148S probably benign Het
Psen1 G A 12: 83,724,572 G209R probably damaging Het
Ralgapa2 T G 2: 146,388,500 K963N probably damaging Het
Rdh12 A G 12: 79,209,065 T9A probably benign Het
Rgma G T 7: 73,417,794 A360S probably benign Het
Sag G A 1: 87,828,441 V257I probably benign Het
Scaf1 T C 7: 45,008,297 E386G probably damaging Het
Slc4a10 A G 2: 62,313,286 E1055G probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Spata46 A G 1: 170,312,004 T191A probably benign Het
Tub C T 7: 109,020,954 R102* probably null Het
Ugt3a1 T G 15: 9,306,292 L176V possibly damaging Het
Vmn2r15 T A 5: 109,294,148 I140L probably benign Het
Wdr44 T G X: 23,796,059 C645G probably damaging Het
Zfp322a C T 13: 23,356,775 V266I probably benign Het
Zfp663 T C 2: 165,352,572 R576G probably damaging Het
Other mutations in Tgm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01990:Tgm2 APN 2 158124131 missense probably benign
IGL03110:Tgm2 APN 2 158131490 nonsense probably null
IGL03397:Tgm2 APN 2 158120258 missense probably damaging 1.00
R0595:Tgm2 UTSW 2 158143042 missense probably damaging 1.00
R0786:Tgm2 UTSW 2 158124381 missense probably damaging 1.00
R1019:Tgm2 UTSW 2 158124154 nonsense probably null
R1732:Tgm2 UTSW 2 158134357 missense probably damaging 1.00
R1776:Tgm2 UTSW 2 158131459 missense probably benign 0.00
R1863:Tgm2 UTSW 2 158124219 missense probably damaging 1.00
R2863:Tgm2 UTSW 2 158143099 missense probably benign 0.01
R3036:Tgm2 UTSW 2 158124247 missense probably benign 0.00
R4200:Tgm2 UTSW 2 158132490 missense probably benign
R4370:Tgm2 UTSW 2 158124301 nonsense probably null
R4612:Tgm2 UTSW 2 158124204 missense probably benign 0.16
R5100:Tgm2 UTSW 2 158127164 missense probably benign 0.33
R5213:Tgm2 UTSW 2 158143060 missense possibly damaging 0.88
R5253:Tgm2 UTSW 2 158129438 missense probably damaging 1.00
R5585:Tgm2 UTSW 2 158131455 nonsense probably null
R5593:Tgm2 UTSW 2 158127342 missense probably damaging 1.00
R5616:Tgm2 UTSW 2 158128720 missense probably damaging 1.00
R5796:Tgm2 UTSW 2 158118904 missense probably benign 0.00
R5821:Tgm2 UTSW 2 158143054 missense possibly damaging 0.81
R5842:Tgm2 UTSW 2 158143081 missense probably damaging 1.00
R6317:Tgm2 UTSW 2 158124150 missense probably benign 0.18
R6610:Tgm2 UTSW 2 158143100 nonsense probably null
R7134:Tgm2 UTSW 2 158138892 missense probably benign
R7151:Tgm2 UTSW 2 158129395 missense possibly damaging 0.95
R7268:Tgm2 UTSW 2 158120268 nonsense probably null
X0058:Tgm2 UTSW 2 158124147 missense probably benign 0.01
X0067:Tgm2 UTSW 2 158118845 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATGAAACACTGGATGTACTGGGCAG -3'
(R):5'- CCAGGACTCTGAAAAGCCAGCTTAC -3'

Sequencing Primer
(F):5'- CAGGTGGAGCCTTACCAGAG -3'
(R):5'- ATCGAGCCTTGTTGCCG -3'
Posted On2014-03-17