Incidental Mutation 'R1395:Ift81'
ID162795
Institutional Source Beutler Lab
Gene Symbol Ift81
Ensembl Gene ENSMUSG00000029469
Gene Nameintraflagellar transport 81
SynonymsCDV-1R, Cdv1
MMRRC Submission 039457-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1395 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location122550204-122614518 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 122568923 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 485 (D485E)
Ref Sequence ENSEMBL: ENSMUSP00000031426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031426]
Predicted Effect probably benign
Transcript: ENSMUST00000031426
AA Change: D485E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000031426
Gene: ENSMUSG00000029469
AA Change: D485E

DomainStartEndE-ValueType
PDB:4LVP|A 5 128 2e-23 PDB
coiled coil region 167 258 N/A INTRINSIC
coiled coil region 308 383 N/A INTRINSIC
coiled coil region 503 591 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197208
Meta Mutation Damage Score 0.1008 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, together with IFT74, forms a tubulin-binding module of intraflagellar transport complex B. This module is involved in transport of tubulin within the cilium, and the encoded protein is required for ciliogenesis. Mutations in this gene are a cause of short-rib polydactyly syndromes. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A G 5: 113,101,496 Y122H probably damaging Het
4932431P20Rik T A 7: 29,531,387 noncoding transcript Het
A330070K13Rik A G 5: 130,379,141 probably benign Het
Abcc2 A G 19: 43,833,940 R1406G probably benign Het
Adgrv1 G T 13: 81,386,788 T5786K probably benign Het
Ankrd27 T C 7: 35,615,869 F481S possibly damaging Het
Arhgap11a C T 2: 113,833,122 V939I probably benign Het
Arhgap12 T C 18: 6,037,058 N561S probably benign Het
Arhgef12 T C 9: 43,005,870 H391R probably damaging Het
Asb3 T C 11: 31,101,032 probably benign Het
C2cd5 T C 6: 143,061,738 probably benign Het
Ccdc85a T C 11: 28,583,412 K44R possibly damaging Het
Cep128 C T 12: 91,266,980 R438Q probably benign Het
Cep192 A G 18: 67,858,921 T1957A probably damaging Het
Col20a1 T A 2: 180,998,607 V519E probably damaging Het
Cylc2 A G 4: 51,228,366 K146E possibly damaging Het
Dst T C 1: 34,165,155 probably null Het
Eef1a1 C T 9: 78,479,018 V402I probably benign Het
Esyt3 T C 9: 99,316,782 probably benign Het
Extl3 A G 14: 65,077,496 V79A possibly damaging Het
Fat3 C T 9: 16,246,916 V1133I probably benign Het
Fcgbp A G 7: 28,093,379 H936R probably damaging Het
Fdxacb1 TAGAC T 9: 50,772,496 probably null Het
Fryl T C 5: 73,072,912 H1634R probably damaging Het
Gm44511 G A 6: 128,820,330 S32L possibly damaging Het
Gm597 T C 1: 28,776,809 E714G possibly damaging Het
Gm8374 G T 14: 7,364,174 N55K probably benign Het
Gria1 T A 11: 57,283,566 I558N probably damaging Het
Gse1 G T 8: 120,574,999 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hectd4 T C 5: 121,328,513 probably null Het
Herc1 T C 9: 66,439,181 I1943T probably benign Het
Ift172 T C 5: 31,285,238 probably benign Het
Lactb T C 9: 66,971,379 probably benign Het
Map1a C T 2: 121,303,925 H1741Y probably benign Het
Map1lc3b T C 8: 121,596,720 Y110H probably benign Het
Mlh1 T C 9: 111,247,377 D304G probably damaging Het
Myo1f A G 17: 33,583,740 D386G probably damaging Het
Ncoa4 T A 14: 32,172,841 probably null Het
Neto1 T C 18: 86,398,019 probably benign Het
Nf1 T C 11: 79,535,983 V1741A possibly damaging Het
Nkain2 C A 10: 32,890,189 probably benign Het
Obsl1 T C 1: 75,492,665 S109G probably damaging Het
Olfr12 T A 1: 92,620,545 I213N probably benign Het
Olfr1347 T A 7: 6,488,362 T171S probably damaging Het
Olfr564 G A 7: 102,804,207 C243Y possibly damaging Het
Olfr615 T C 7: 103,561,119 L214P possibly damaging Het
Phlpp1 T C 1: 106,350,618 V920A possibly damaging Het
Prrxl1 C T 14: 32,608,369 P148S probably benign Het
Psen1 G A 12: 83,724,572 G209R probably damaging Het
Ralgapa2 T G 2: 146,388,500 K963N probably damaging Het
Rdh12 A G 12: 79,209,065 T9A probably benign Het
Rgma G T 7: 73,417,794 A360S probably benign Het
Sag G A 1: 87,828,441 V257I probably benign Het
Scaf1 T C 7: 45,008,297 E386G probably damaging Het
Slc4a10 A G 2: 62,313,286 E1055G probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Spata46 A G 1: 170,312,004 T191A probably benign Het
Tgm2 T A 2: 158,124,252 H494L probably benign Het
Tub C T 7: 109,020,954 R102* probably null Het
Ugt3a1 T G 15: 9,306,292 L176V possibly damaging Het
Vmn2r15 T A 5: 109,294,148 I140L probably benign Het
Wdr44 T G X: 23,796,059 C645G probably damaging Het
Zfp322a C T 13: 23,356,775 V266I probably benign Het
Zfp663 T C 2: 165,352,572 R576G probably damaging Het
Other mutations in Ift81
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01321:Ift81 APN 5 122610968 missense probably damaging 1.00
IGL01867:Ift81 APN 5 122602676 splice site probably benign
IGL01927:Ift81 APN 5 122593129 missense probably benign 0.25
IGL02954:Ift81 APN 5 122610185 splice site probably benign
IGL03003:Ift81 APN 5 122594662 missense probably benign 0.01
R1179:Ift81 UTSW 5 122602710 missense probably benign 0.22
R1394:Ift81 UTSW 5 122568923 missense probably benign 0.00
R1962:Ift81 UTSW 5 122560709 missense probably benign 0.01
R2084:Ift81 UTSW 5 122567347 missense probably benign 0.00
R4019:Ift81 UTSW 5 122593129 missense probably benign 0.25
R4769:Ift81 UTSW 5 122594593 missense probably benign 0.16
R4849:Ift81 UTSW 5 122591219 missense probably damaging 1.00
R4905:Ift81 UTSW 5 122591079 critical splice donor site probably null
R4924:Ift81 UTSW 5 122594616 missense possibly damaging 0.86
R5110:Ift81 UTSW 5 122551058 missense probably benign 0.02
R5299:Ift81 UTSW 5 122607056 missense probably damaging 0.99
R5387:Ift81 UTSW 5 122555535 missense probably damaging 1.00
R6190:Ift81 UTSW 5 122551100 missense probably benign 0.00
R6241:Ift81 UTSW 5 122602351 missense probably benign 0.38
R6404:Ift81 UTSW 5 122611006 missense probably damaging 1.00
R6647:Ift81 UTSW 5 122610166 nonsense probably null
R7155:Ift81 UTSW 5 122568999 missense probably damaging 0.99
R7170:Ift81 UTSW 5 122555533 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTGAAGTCTCAAGCAACGGTGTG -3'
(R):5'- GAAGAAGATGCCAATACTCATGGCCT -3'

Sequencing Primer
(F):5'- ccccctccttgttcctctg -3'
(R):5'- GGCCTATTCATTTCTTATAGCGAAC -3'
Posted On2014-03-17