Incidental Mutation 'R1395:Gm44511'
ID162797
Institutional Source Beutler Lab
Gene Symbol Gm44511
Ensembl Gene ENSMUSG00000107872
Gene Namepredicted gene 44511
Synonyms
MMRRC Submission 039457-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R1395 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location128780285-128826315 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 128820330 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 32 (S32L)
Ref Sequence ENSEMBL: ENSMUSP00000134022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032472] [ENSMUST00000172887] [ENSMUST00000174544] [ENSMUST00000204394] [ENSMUST00000204423] [ENSMUST00000204677] [ENSMUST00000204756] [ENSMUST00000205130]
Predicted Effect probably benign
Transcript: ENSMUST00000032472
AA Change: S65L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032472
Gene: ENSMUSG00000079298
AA Change: S65L

DomainStartEndE-ValueType
transmembrane domain 44 66 N/A INTRINSIC
CLECT 94 211 2.04e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172887
AA Change: S65L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134637
Gene: ENSMUSG00000079298
AA Change: S65L

DomainStartEndE-ValueType
transmembrane domain 44 66 N/A INTRINSIC
PDB:3M9Z|A 89 138 1e-25 PDB
SCOP:d1e87a_ 94 137 2e-10 SMART
Blast:CLECT 94 138 2e-25 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000174544
AA Change: S32L

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000134022
Gene: ENSMUSG00000079298
AA Change: S32L

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
PDB:3M9Z|A 56 97 8e-21 PDB
Blast:CLECT 61 97 1e-20 BLAST
SCOP:d1e87a_ 61 97 8e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204394
AA Change: S65L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000145481
Gene: ENSMUSG00000107872
AA Change: S65L

DomainStartEndE-ValueType
transmembrane domain 44 66 N/A INTRINSIC
CLECT 94 211 8.5e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204423
AA Change: S65L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000145327
Gene: ENSMUSG00000107872
AA Change: S65L

DomainStartEndE-ValueType
transmembrane domain 44 66 N/A INTRINSIC
CLECT 94 211 8.7e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204677
AA Change: S65L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000145287
Gene: ENSMUSG00000107872
AA Change: S65L

DomainStartEndE-ValueType
transmembrane domain 44 66 N/A INTRINSIC
PDB:3M9Z|A 89 144 2e-30 PDB
SCOP:d1e87a_ 94 143 2e-12 SMART
Blast:CLECT 94 144 3e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000204756
AA Change: S56L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144777
Gene: ENSMUSG00000107872
AA Change: S56L

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
CLECT 85 185 1e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205130
AA Change: S65L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000144964
Gene: ENSMUSG00000079298
AA Change: S65L

DomainStartEndE-ValueType
transmembrane domain 44 66 N/A INTRINSIC
CLECT 75 187 1.5e-18 SMART
Meta Mutation Damage Score 0.1056 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency 99% (70/71)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A G 5: 113,101,496 Y122H probably damaging Het
4932431P20Rik T A 7: 29,531,387 noncoding transcript Het
A330070K13Rik A G 5: 130,379,141 probably benign Het
Abcc2 A G 19: 43,833,940 R1406G probably benign Het
Adgrv1 G T 13: 81,386,788 T5786K probably benign Het
Ankrd27 T C 7: 35,615,869 F481S possibly damaging Het
Arhgap11a C T 2: 113,833,122 V939I probably benign Het
Arhgap12 T C 18: 6,037,058 N561S probably benign Het
Arhgef12 T C 9: 43,005,870 H391R probably damaging Het
Asb3 T C 11: 31,101,032 probably benign Het
C2cd5 T C 6: 143,061,738 probably benign Het
Ccdc85a T C 11: 28,583,412 K44R possibly damaging Het
Cep128 C T 12: 91,266,980 R438Q probably benign Het
Cep192 A G 18: 67,858,921 T1957A probably damaging Het
Col20a1 T A 2: 180,998,607 V519E probably damaging Het
Cylc2 A G 4: 51,228,366 K146E possibly damaging Het
Dst T C 1: 34,165,155 probably null Het
Eef1a1 C T 9: 78,479,018 V402I probably benign Het
Esyt3 T C 9: 99,316,782 probably benign Het
Extl3 A G 14: 65,077,496 V79A possibly damaging Het
Fat3 C T 9: 16,246,916 V1133I probably benign Het
Fcgbp A G 7: 28,093,379 H936R probably damaging Het
Fdxacb1 TAGAC T 9: 50,772,496 probably null Het
Fryl T C 5: 73,072,912 H1634R probably damaging Het
Gm597 T C 1: 28,776,809 E714G possibly damaging Het
Gm8374 G T 14: 7,364,174 N55K probably benign Het
Gria1 T A 11: 57,283,566 I558N probably damaging Het
Gse1 G T 8: 120,574,999 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hectd4 T C 5: 121,328,513 probably null Het
Herc1 T C 9: 66,439,181 I1943T probably benign Het
Ift172 T C 5: 31,285,238 probably benign Het
Ift81 G T 5: 122,568,923 D485E probably benign Het
Lactb T C 9: 66,971,379 probably benign Het
Map1a C T 2: 121,303,925 H1741Y probably benign Het
Map1lc3b T C 8: 121,596,720 Y110H probably benign Het
Mlh1 T C 9: 111,247,377 D304G probably damaging Het
Myo1f A G 17: 33,583,740 D386G probably damaging Het
Ncoa4 T A 14: 32,172,841 probably null Het
Neto1 T C 18: 86,398,019 probably benign Het
Nf1 T C 11: 79,535,983 V1741A possibly damaging Het
Nkain2 C A 10: 32,890,189 probably benign Het
Obsl1 T C 1: 75,492,665 S109G probably damaging Het
Olfr12 T A 1: 92,620,545 I213N probably benign Het
Olfr1347 T A 7: 6,488,362 T171S probably damaging Het
Olfr564 G A 7: 102,804,207 C243Y possibly damaging Het
Olfr615 T C 7: 103,561,119 L214P possibly damaging Het
Phlpp1 T C 1: 106,350,618 V920A possibly damaging Het
Prrxl1 C T 14: 32,608,369 P148S probably benign Het
Psen1 G A 12: 83,724,572 G209R probably damaging Het
Ralgapa2 T G 2: 146,388,500 K963N probably damaging Het
Rdh12 A G 12: 79,209,065 T9A probably benign Het
Rgma G T 7: 73,417,794 A360S probably benign Het
Sag G A 1: 87,828,441 V257I probably benign Het
Scaf1 T C 7: 45,008,297 E386G probably damaging Het
Slc4a10 A G 2: 62,313,286 E1055G probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Spata46 A G 1: 170,312,004 T191A probably benign Het
Tgm2 T A 2: 158,124,252 H494L probably benign Het
Tub C T 7: 109,020,954 R102* probably null Het
Ugt3a1 T G 15: 9,306,292 L176V possibly damaging Het
Vmn2r15 T A 5: 109,294,148 I140L probably benign Het
Wdr44 T G X: 23,796,059 C645G probably damaging Het
Zfp322a C T 13: 23,356,775 V266I probably benign Het
Zfp663 T C 2: 165,352,572 R576G probably damaging Het
Other mutations in Gm44511
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03008:Gm44511 APN 6 128784096 splice site probably benign
IGL03028:Gm44511 APN 6 128780395 missense probably damaging 1.00
R1394:Gm44511 UTSW 6 128820330 missense possibly damaging 0.66
R1959:Gm44511 UTSW 6 128820271 missense probably damaging 0.98
R2190:Gm44511 UTSW 6 128826200 missense possibly damaging 0.46
R6026:Gm44511 UTSW 6 128820277 missense possibly damaging 0.89
R6633:Gm44511 UTSW 6 128826242 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTGAAGTGTCCTGCACCATCATC -3'
(R):5'- TGTAGCCTGACAGCCCTGTGAATC -3'

Sequencing Primer
(F):5'- CAGGTCACATGACTTTTGACAAG -3'
(R):5'- GCCCTGTGAATCAAAATGATCCTG -3'
Posted On2014-03-17