Incidental Mutation 'R1395:Olfr564'
ID162805
Institutional Source Beutler Lab
Gene Symbol Olfr564
Ensembl Gene ENSMUSG00000048469
Gene Nameolfactory receptor 564
SynonymsGA_x6K02T2PBJ9-5513635-5514627, MOR14-10
MMRRC Submission 039457-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R1395 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location102803480-102804430 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 102804207 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 243 (C243Y)
Ref Sequence ENSEMBL: ENSMUSP00000129376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061096]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061096
AA Change: C243Y

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129376
Gene: ENSMUSG00000048469
AA Change: C243Y

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 3.6e-117 PFAM
Pfam:7TM_GPCR_Srsx 38 256 4.7e-8 PFAM
Pfam:7tm_1 43 294 2.5e-20 PFAM
Meta Mutation Damage Score 0.0696 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A G 5: 113,101,496 Y122H probably damaging Het
4932431P20Rik T A 7: 29,531,387 noncoding transcript Het
A330070K13Rik A G 5: 130,379,141 probably benign Het
Abcc2 A G 19: 43,833,940 R1406G probably benign Het
Adgrv1 G T 13: 81,386,788 T5786K probably benign Het
Ankrd27 T C 7: 35,615,869 F481S possibly damaging Het
Arhgap11a C T 2: 113,833,122 V939I probably benign Het
Arhgap12 T C 18: 6,037,058 N561S probably benign Het
Arhgef12 T C 9: 43,005,870 H391R probably damaging Het
Asb3 T C 11: 31,101,032 probably benign Het
C2cd5 T C 6: 143,061,738 probably benign Het
Ccdc85a T C 11: 28,583,412 K44R possibly damaging Het
Cep128 C T 12: 91,266,980 R438Q probably benign Het
Cep192 A G 18: 67,858,921 T1957A probably damaging Het
Col20a1 T A 2: 180,998,607 V519E probably damaging Het
Cylc2 A G 4: 51,228,366 K146E possibly damaging Het
Dst T C 1: 34,165,155 probably null Het
Eef1a1 C T 9: 78,479,018 V402I probably benign Het
Esyt3 T C 9: 99,316,782 probably benign Het
Extl3 A G 14: 65,077,496 V79A possibly damaging Het
Fat3 C T 9: 16,246,916 V1133I probably benign Het
Fcgbp A G 7: 28,093,379 H936R probably damaging Het
Fdxacb1 TAGAC T 9: 50,772,496 probably null Het
Fryl T C 5: 73,072,912 H1634R probably damaging Het
Gm44511 G A 6: 128,820,330 S32L possibly damaging Het
Gm597 T C 1: 28,776,809 E714G possibly damaging Het
Gm8374 G T 14: 7,364,174 N55K probably benign Het
Gria1 T A 11: 57,283,566 I558N probably damaging Het
Gse1 G T 8: 120,574,999 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hectd4 T C 5: 121,328,513 probably null Het
Herc1 T C 9: 66,439,181 I1943T probably benign Het
Ift172 T C 5: 31,285,238 probably benign Het
Ift81 G T 5: 122,568,923 D485E probably benign Het
Lactb T C 9: 66,971,379 probably benign Het
Map1a C T 2: 121,303,925 H1741Y probably benign Het
Map1lc3b T C 8: 121,596,720 Y110H probably benign Het
Mlh1 T C 9: 111,247,377 D304G probably damaging Het
Myo1f A G 17: 33,583,740 D386G probably damaging Het
Ncoa4 T A 14: 32,172,841 probably null Het
Neto1 T C 18: 86,398,019 probably benign Het
Nf1 T C 11: 79,535,983 V1741A possibly damaging Het
Nkain2 C A 10: 32,890,189 probably benign Het
Obsl1 T C 1: 75,492,665 S109G probably damaging Het
Olfr12 T A 1: 92,620,545 I213N probably benign Het
Olfr1347 T A 7: 6,488,362 T171S probably damaging Het
Olfr615 T C 7: 103,561,119 L214P possibly damaging Het
Phlpp1 T C 1: 106,350,618 V920A possibly damaging Het
Prrxl1 C T 14: 32,608,369 P148S probably benign Het
Psen1 G A 12: 83,724,572 G209R probably damaging Het
Ralgapa2 T G 2: 146,388,500 K963N probably damaging Het
Rdh12 A G 12: 79,209,065 T9A probably benign Het
Rgma G T 7: 73,417,794 A360S probably benign Het
Sag G A 1: 87,828,441 V257I probably benign Het
Scaf1 T C 7: 45,008,297 E386G probably damaging Het
Slc4a10 A G 2: 62,313,286 E1055G probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Spata46 A G 1: 170,312,004 T191A probably benign Het
Tgm2 T A 2: 158,124,252 H494L probably benign Het
Tub C T 7: 109,020,954 R102* probably null Het
Ugt3a1 T G 15: 9,306,292 L176V possibly damaging Het
Vmn2r15 T A 5: 109,294,148 I140L probably benign Het
Wdr44 T G X: 23,796,059 C645G probably damaging Het
Zfp322a C T 13: 23,356,775 V266I probably benign Het
Zfp663 T C 2: 165,352,572 R576G probably damaging Het
Other mutations in Olfr564
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Olfr564 APN 7 102803854 nonsense probably null
IGL03248:Olfr564 APN 7 102803639 nonsense probably null
R1108:Olfr564 UTSW 7 102803850 missense probably benign 0.08
R1422:Olfr564 UTSW 7 102803850 missense probably benign 0.08
R4032:Olfr564 UTSW 7 102804189 missense probably benign 0.00
R5168:Olfr564 UTSW 7 102804321 missense probably benign
R5269:Olfr564 UTSW 7 102804120 missense probably benign
R5639:Olfr564 UTSW 7 102803993 missense probably benign
R5930:Olfr564 UTSW 7 102804274 missense probably damaging 1.00
R6019:Olfr564 UTSW 7 102804284 nonsense probably null
R7206:Olfr564 UTSW 7 102803684 missense probably damaging 1.00
R7254:Olfr564 UTSW 7 102803558 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCAGCCATGTGCTTCATCACTC -3'
(R):5'- AACACAGCCTTCCGTATCTTCTTGG -3'

Sequencing Primer
(F):5'- ATGTGCTTCATCACTCCTACTG -3'
(R):5'- CTTGGTCTTCACACTGTAGATGATG -3'
Posted On2014-03-17