Incidental Mutation 'R1395:Map1lc3b'
ID162809
Institutional Source Beutler Lab
Gene Symbol Map1lc3b
Ensembl Gene ENSMUSG00000031812
Gene Namemicrotubule-associated protein 1 light chain 3 beta
SynonymsLC3b, Atg8, 1010001C15Rik, Map1lc3
MMRRC Submission 039457-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1395 (G1)
Quality Score205
Status Validated
Chromosome8
Chromosomal Location121590361-121598760 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121596720 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 110 (Y110H)
Ref Sequence ENSEMBL: ENSMUSP00000034270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034270] [ENSMUST00000046386] [ENSMUST00000127664] [ENSMUST00000181521] [ENSMUST00000181826] [ENSMUST00000181948]
Predicted Effect probably benign
Transcript: ENSMUST00000034270
AA Change: Y110H

PolyPhen 2 Score 0.379 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000034270
Gene: ENSMUSG00000031812
AA Change: Y110H

DomainStartEndE-ValueType
Pfam:Atg8 15 120 5.8e-47 PFAM
Pfam:APG12 33 120 8.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000046386
SMART Domains Protein: ENSMUSP00000040360
Gene: ENSMUSG00000061410

DomainStartEndE-ValueType
low complexity region 30 41 N/A INTRINSIC
low complexity region 129 145 N/A INTRINSIC
low complexity region 206 225 N/A INTRINSIC
low complexity region 246 265 N/A INTRINSIC
Blast:SAM 299 349 2e-25 BLAST
SCOP:d1kw4a_ 307 358 1e-6 SMART
low complexity region 422 432 N/A INTRINSIC
low complexity region 438 454 N/A INTRINSIC
low complexity region 532 543 N/A INTRINSIC
low complexity region 709 790 N/A INTRINSIC
low complexity region 791 808 N/A INTRINSIC
ZnF_C2HC 914 930 3.44e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154725
SMART Domains Protein: ENSMUSP00000120570
Gene: ENSMUSG00000061410

DomainStartEndE-ValueType
low complexity region 7 88 N/A INTRINSIC
low complexity region 89 106 N/A INTRINSIC
ZnF_C2HC 212 228 3.44e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180548
Predicted Effect probably benign
Transcript: ENSMUST00000181521
AA Change: Y51H

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000137996
Gene: ENSMUSG00000031812
AA Change: Y51H

DomainStartEndE-ValueType
Pfam:Atg8 1 61 2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000181826
Predicted Effect probably benign
Transcript: ENSMUST00000181948
AA Change: Y145H

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000137754
Gene: ENSMUSG00000031812
AA Change: Y145H

DomainStartEndE-ValueType
Pfam:Atg8 60 155 2.6e-38 PFAM
Pfam:APG12 68 155 2.8e-9 PFAM
Meta Mutation Damage Score 0.726 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a subunit of neuronal microtubule-associated MAP1A and MAP1B proteins, which are involved in microtubule assembly and important for neurogenesis. Studies on the rat homolog implicate a role for this gene in autophagy, a process that involves the bulk degradation of cytoplasmic component. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele develop, breed and behave normally and display a normal life span. In culture, mutant MEFs maintain wild-type levels of fibronectin (FN) protein despite reduced FN synthesis, and show normal induction of autophagosomes under starvation conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A G 5: 113,101,496 Y122H probably damaging Het
4932431P20Rik T A 7: 29,531,387 noncoding transcript Het
A330070K13Rik A G 5: 130,379,141 probably benign Het
Abcc2 A G 19: 43,833,940 R1406G probably benign Het
Adgrv1 G T 13: 81,386,788 T5786K probably benign Het
Ankrd27 T C 7: 35,615,869 F481S possibly damaging Het
Arhgap11a C T 2: 113,833,122 V939I probably benign Het
Arhgap12 T C 18: 6,037,058 N561S probably benign Het
Arhgef12 T C 9: 43,005,870 H391R probably damaging Het
Asb3 T C 11: 31,101,032 probably benign Het
C2cd5 T C 6: 143,061,738 probably benign Het
Ccdc85a T C 11: 28,583,412 K44R possibly damaging Het
Cep128 C T 12: 91,266,980 R438Q probably benign Het
Cep192 A G 18: 67,858,921 T1957A probably damaging Het
Col20a1 T A 2: 180,998,607 V519E probably damaging Het
Cylc2 A G 4: 51,228,366 K146E possibly damaging Het
Dst T C 1: 34,165,155 probably null Het
Eef1a1 C T 9: 78,479,018 V402I probably benign Het
Esyt3 T C 9: 99,316,782 probably benign Het
Extl3 A G 14: 65,077,496 V79A possibly damaging Het
Fat3 C T 9: 16,246,916 V1133I probably benign Het
Fcgbp A G 7: 28,093,379 H936R probably damaging Het
Fdxacb1 TAGAC T 9: 50,772,496 probably null Het
Fryl T C 5: 73,072,912 H1634R probably damaging Het
Gm44511 G A 6: 128,820,330 S32L possibly damaging Het
Gm597 T C 1: 28,776,809 E714G possibly damaging Het
Gm8374 G T 14: 7,364,174 N55K probably benign Het
Gria1 T A 11: 57,283,566 I558N probably damaging Het
Gse1 G T 8: 120,574,999 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hectd4 T C 5: 121,328,513 probably null Het
Herc1 T C 9: 66,439,181 I1943T probably benign Het
Ift172 T C 5: 31,285,238 probably benign Het
Ift81 G T 5: 122,568,923 D485E probably benign Het
Lactb T C 9: 66,971,379 probably benign Het
Map1a C T 2: 121,303,925 H1741Y probably benign Het
Mlh1 T C 9: 111,247,377 D304G probably damaging Het
Myo1f A G 17: 33,583,740 D386G probably damaging Het
Ncoa4 T A 14: 32,172,841 probably null Het
Neto1 T C 18: 86,398,019 probably benign Het
Nf1 T C 11: 79,535,983 V1741A possibly damaging Het
Nkain2 C A 10: 32,890,189 probably benign Het
Obsl1 T C 1: 75,492,665 S109G probably damaging Het
Olfr12 T A 1: 92,620,545 I213N probably benign Het
Olfr1347 T A 7: 6,488,362 T171S probably damaging Het
Olfr564 G A 7: 102,804,207 C243Y possibly damaging Het
Olfr615 T C 7: 103,561,119 L214P possibly damaging Het
Phlpp1 T C 1: 106,350,618 V920A possibly damaging Het
Prrxl1 C T 14: 32,608,369 P148S probably benign Het
Psen1 G A 12: 83,724,572 G209R probably damaging Het
Ralgapa2 T G 2: 146,388,500 K963N probably damaging Het
Rdh12 A G 12: 79,209,065 T9A probably benign Het
Rgma G T 7: 73,417,794 A360S probably benign Het
Sag G A 1: 87,828,441 V257I probably benign Het
Scaf1 T C 7: 45,008,297 E386G probably damaging Het
Slc4a10 A G 2: 62,313,286 E1055G probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Spata46 A G 1: 170,312,004 T191A probably benign Het
Tgm2 T A 2: 158,124,252 H494L probably benign Het
Tub C T 7: 109,020,954 R102* probably null Het
Ugt3a1 T G 15: 9,306,292 L176V possibly damaging Het
Vmn2r15 T A 5: 109,294,148 I140L probably benign Het
Wdr44 T G X: 23,796,059 C645G probably damaging Het
Zfp322a C T 13: 23,356,775 V266I probably benign Het
Zfp663 T C 2: 165,352,572 R576G probably damaging Het
Other mutations in Map1lc3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02709:Map1lc3b APN 8 121596029 missense probably damaging 1.00
apollo UTSW 8 121596720 missense probably benign 0.38
R0201:Map1lc3b UTSW 8 121590550 missense possibly damaging 0.78
R1496:Map1lc3b UTSW 8 121596600 missense possibly damaging 0.47
R1769:Map1lc3b UTSW 8 121593487 splice site probably benign
R2571:Map1lc3b UTSW 8 121593474 intron probably null
R6272:Map1lc3b UTSW 8 121596690 missense probably benign 0.31
R6788:Map1lc3b UTSW 8 121593577 missense probably benign
R7406:Map1lc3b UTSW 8 121590616 missense unknown
Predicted Primers PCR Primer
(F):5'- TGTCAGACCCTGATCACAGCCATC -3'
(R):5'- TTTAGAGAAGGCAGCAGGTCCCAG -3'

Sequencing Primer
(F):5'- GAGGCCCTAAGTTCTGTACAC -3'
(R):5'- GGCTGATGAACAGTTCCTAATACC -3'
Posted On2014-03-17