Incidental Mutation 'R1395:Arhgef12'
ID162811
Institutional Source Beutler Lab
Gene Symbol Arhgef12
Ensembl Gene ENSMUSG00000059495
Gene NameRho guanine nucleotide exchange factor (GEF) 12
SynonymsLARG, 2310014B11Rik
MMRRC Submission 039457-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.943) question?
Stock #R1395 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location42963842-43107239 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43005870 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 391 (H391R)
Ref Sequence ENSEMBL: ENSMUSP00000126598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072767] [ENSMUST00000165665]
Predicted Effect probably damaging
Transcript: ENSMUST00000072767
AA Change: H390R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072547
Gene: ENSMUSG00000059495
AA Change: H390R

DomainStartEndE-ValueType
low complexity region 49 64 N/A INTRINSIC
PDZ 80 148 1.64e-19 SMART
coiled coil region 196 259 N/A INTRINSIC
low complexity region 293 313 N/A INTRINSIC
Pfam:RGS-like 368 558 8.6e-87 PFAM
low complexity region 583 596 N/A INTRINSIC
low complexity region 663 676 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
RhoGEF 791 976 6.35e-66 SMART
PH 1020 1134 6.26e-6 SMART
low complexity region 1256 1269 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165665
AA Change: H391R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126598
Gene: ENSMUSG00000059495
AA Change: H391R

DomainStartEndE-ValueType
low complexity region 49 64 N/A INTRINSIC
PDZ 80 148 1.64e-19 SMART
coiled coil region 196 259 N/A INTRINSIC
low complexity region 293 313 N/A INTRINSIC
Pfam:RGS-like 369 559 1.6e-88 PFAM
low complexity region 584 597 N/A INTRINSIC
low complexity region 664 677 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
RhoGEF 792 977 6.35e-66 SMART
PH 1021 1135 6.26e-6 SMART
low complexity region 1257 1270 N/A INTRINSIC
Meta Mutation Damage Score 0.172 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli working through G protein-coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein has been observed to form a myeloid/lymphoid fusion partner in acute myeloid leukemia. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased sensitivity to certain vasoconstrictors and resistance to salt-induced hypertension. Mice homozygous for a different knock-out allele exhibit partial prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A G 5: 113,101,496 Y122H probably damaging Het
4932431P20Rik T A 7: 29,531,387 noncoding transcript Het
A330070K13Rik A G 5: 130,379,141 probably benign Het
Abcc2 A G 19: 43,833,940 R1406G probably benign Het
Adgrv1 G T 13: 81,386,788 T5786K probably benign Het
Ankrd27 T C 7: 35,615,869 F481S possibly damaging Het
Arhgap11a C T 2: 113,833,122 V939I probably benign Het
Arhgap12 T C 18: 6,037,058 N561S probably benign Het
Asb3 T C 11: 31,101,032 probably benign Het
C2cd5 T C 6: 143,061,738 probably benign Het
Ccdc85a T C 11: 28,583,412 K44R possibly damaging Het
Cep128 C T 12: 91,266,980 R438Q probably benign Het
Cep192 A G 18: 67,858,921 T1957A probably damaging Het
Col20a1 T A 2: 180,998,607 V519E probably damaging Het
Cylc2 A G 4: 51,228,366 K146E possibly damaging Het
Dst T C 1: 34,165,155 probably null Het
Eef1a1 C T 9: 78,479,018 V402I probably benign Het
Esyt3 T C 9: 99,316,782 probably benign Het
Extl3 A G 14: 65,077,496 V79A possibly damaging Het
Fat3 C T 9: 16,246,916 V1133I probably benign Het
Fcgbp A G 7: 28,093,379 H936R probably damaging Het
Fdxacb1 TAGAC T 9: 50,772,496 probably null Het
Fryl T C 5: 73,072,912 H1634R probably damaging Het
Gm44511 G A 6: 128,820,330 S32L possibly damaging Het
Gm597 T C 1: 28,776,809 E714G possibly damaging Het
Gm8374 G T 14: 7,364,174 N55K probably benign Het
Gria1 T A 11: 57,283,566 I558N probably damaging Het
Gse1 G T 8: 120,574,999 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hectd4 T C 5: 121,328,513 probably null Het
Herc1 T C 9: 66,439,181 I1943T probably benign Het
Ift172 T C 5: 31,285,238 probably benign Het
Ift81 G T 5: 122,568,923 D485E probably benign Het
Lactb T C 9: 66,971,379 probably benign Het
Map1a C T 2: 121,303,925 H1741Y probably benign Het
Map1lc3b T C 8: 121,596,720 Y110H probably benign Het
Mlh1 T C 9: 111,247,377 D304G probably damaging Het
Myo1f A G 17: 33,583,740 D386G probably damaging Het
Ncoa4 T A 14: 32,172,841 probably null Het
Neto1 T C 18: 86,398,019 probably benign Het
Nf1 T C 11: 79,535,983 V1741A possibly damaging Het
Nkain2 C A 10: 32,890,189 probably benign Het
Obsl1 T C 1: 75,492,665 S109G probably damaging Het
Olfr12 T A 1: 92,620,545 I213N probably benign Het
Olfr1347 T A 7: 6,488,362 T171S probably damaging Het
Olfr564 G A 7: 102,804,207 C243Y possibly damaging Het
Olfr615 T C 7: 103,561,119 L214P possibly damaging Het
Phlpp1 T C 1: 106,350,618 V920A possibly damaging Het
Prrxl1 C T 14: 32,608,369 P148S probably benign Het
Psen1 G A 12: 83,724,572 G209R probably damaging Het
Ralgapa2 T G 2: 146,388,500 K963N probably damaging Het
Rdh12 A G 12: 79,209,065 T9A probably benign Het
Rgma G T 7: 73,417,794 A360S probably benign Het
Sag G A 1: 87,828,441 V257I probably benign Het
Scaf1 T C 7: 45,008,297 E386G probably damaging Het
Slc4a10 A G 2: 62,313,286 E1055G probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Spata46 A G 1: 170,312,004 T191A probably benign Het
Tgm2 T A 2: 158,124,252 H494L probably benign Het
Tub C T 7: 109,020,954 R102* probably null Het
Ugt3a1 T G 15: 9,306,292 L176V possibly damaging Het
Vmn2r15 T A 5: 109,294,148 I140L probably benign Het
Wdr44 T G X: 23,796,059 C645G probably damaging Het
Zfp322a C T 13: 23,356,775 V266I probably benign Het
Zfp663 T C 2: 165,352,572 R576G probably damaging Het
Other mutations in Arhgef12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Arhgef12 APN 9 43020624 missense probably damaging 1.00
IGL00942:Arhgef12 APN 9 42982000 missense probably damaging 1.00
IGL01529:Arhgef12 APN 9 42990055 missense probably damaging 1.00
IGL01845:Arhgef12 APN 9 43022841 missense possibly damaging 0.56
IGL02039:Arhgef12 APN 9 42972267 missense probably benign
IGL02135:Arhgef12 APN 9 42972165 missense possibly damaging 0.68
IGL02272:Arhgef12 APN 9 43001452 missense probably damaging 1.00
IGL02498:Arhgef12 APN 9 42982043 missense probably benign 0.19
IGL02507:Arhgef12 APN 9 42992563 missense probably damaging 1.00
IGL02574:Arhgef12 APN 9 43005623 missense probably damaging 0.99
IGL02586:Arhgef12 APN 9 43005904 nonsense probably null
IGL02803:Arhgef12 APN 9 42972028 missense possibly damaging 0.48
IGL02892:Arhgef12 APN 9 43000972 missense possibly damaging 0.79
IGL02937:Arhgef12 APN 9 43015920 missense probably damaging 0.97
IGL02992:Arhgef12 APN 9 42999077 missense probably damaging 1.00
IGL03028:Arhgef12 APN 9 43026228 missense possibly damaging 0.84
IGL03146:Arhgef12 APN 9 42974570 missense possibly damaging 0.90
IGL03193:Arhgef12 APN 9 42992533 splice site probably benign
IGL03398:Arhgef12 APN 9 42978226 missense probably damaging 1.00
R0019:Arhgef12 UTSW 9 42978233 missense probably damaging 1.00
R0143:Arhgef12 UTSW 9 43005594 missense probably damaging 1.00
R0211:Arhgef12 UTSW 9 42972004 missense probably damaging 0.97
R0330:Arhgef12 UTSW 9 43020686 missense probably damaging 0.97
R0364:Arhgef12 UTSW 9 43018401 missense probably damaging 0.99
R0426:Arhgef12 UTSW 9 42970990 splice site probably null
R0658:Arhgef12 UTSW 9 42981985 missense probably damaging 1.00
R0686:Arhgef12 UTSW 9 42993028 missense probably benign 0.02
R0693:Arhgef12 UTSW 9 43018401 missense probably damaging 0.99
R0990:Arhgef12 UTSW 9 42972381 missense probably benign 0.00
R1147:Arhgef12 UTSW 9 43044256 unclassified probably benign
R1419:Arhgef12 UTSW 9 43027220 missense probably damaging 1.00
R1451:Arhgef12 UTSW 9 42992578 splice site probably benign
R1458:Arhgef12 UTSW 9 42988998 missense probably damaging 0.98
R1654:Arhgef12 UTSW 9 42997660 missense possibly damaging 0.83
R1722:Arhgef12 UTSW 9 43020717 makesense probably null
R1773:Arhgef12 UTSW 9 43005542 critical splice donor site probably null
R1895:Arhgef12 UTSW 9 43005856 missense probably damaging 1.00
R2109:Arhgef12 UTSW 9 42979472 missense possibly damaging 0.75
R2215:Arhgef12 UTSW 9 43005871 missense probably damaging 1.00
R2421:Arhgef12 UTSW 9 43001006 missense probably damaging 1.00
R3967:Arhgef12 UTSW 9 43005551 missense probably damaging 1.00
R3968:Arhgef12 UTSW 9 43005551 missense probably damaging 1.00
R3969:Arhgef12 UTSW 9 43005551 missense probably damaging 1.00
R4077:Arhgef12 UTSW 9 42975292 missense probably damaging 0.99
R4079:Arhgef12 UTSW 9 42975292 missense probably damaging 0.99
R4111:Arhgef12 UTSW 9 42972274 missense probably damaging 1.00
R4302:Arhgef12 UTSW 9 43018349 nonsense probably null
R4327:Arhgef12 UTSW 9 42975229 nonsense probably null
R4462:Arhgef12 UTSW 9 42981982 missense probably damaging 1.00
R4583:Arhgef12 UTSW 9 42977662 missense probably damaging 1.00
R4603:Arhgef12 UTSW 9 43010193 missense probably benign 0.27
R4650:Arhgef12 UTSW 9 42981970 missense probably damaging 1.00
R4741:Arhgef12 UTSW 9 42972153 missense possibly damaging 0.54
R4823:Arhgef12 UTSW 9 43020696 missense probably benign
R4840:Arhgef12 UTSW 9 42975068 missense probably benign 0.04
R4912:Arhgef12 UTSW 9 42993065 nonsense probably null
R5176:Arhgef12 UTSW 9 43020686 missense probably damaging 0.97
R5426:Arhgef12 UTSW 9 42986584 missense probably damaging 1.00
R5579:Arhgef12 UTSW 9 43010193 missense probably benign 0.27
R5838:Arhgef12 UTSW 9 43005608 missense probably damaging 1.00
R6230:Arhgef12 UTSW 9 42988965 missense probably benign 0.04
R6741:Arhgef12 UTSW 9 42972207 missense probably benign 0.05
R6959:Arhgef12 UTSW 9 43015953 missense probably benign
R7252:Arhgef12 UTSW 9 43015909 missense probably benign 0.17
R7470:Arhgef12 UTSW 9 43040552 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATGAAACTCCAGGAAGACACGC -3'
(R):5'- GGACATTCCAGACGGAACCCATTAC -3'

Sequencing Primer
(F):5'- TCTGAATAGAGATAACAGAGCTGTC -3'
(R):5'- cagacggaacccattacaGAAG -3'
Posted On2014-03-17