Incidental Mutation 'R1395:Eef1a1'
ID162815
Institutional Source Beutler Lab
Gene Symbol Eef1a1
Ensembl Gene ENSMUSG00000037742
Gene Nameeukaryotic translation elongation factor 1 alpha 1
Synonyms
MMRRC Submission 039457-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R1395 (G1)
Quality Score223
Status Validated
Chromosome9
Chromosomal Location78478449-78489151 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 78479018 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 402 (V402I)
Ref Sequence ENSEMBL: ENSMUSP00000042457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034896] [ENSMUST00000042235] [ENSMUST00000148238] [ENSMUST00000154207] [ENSMUST00000156988]
Predicted Effect probably benign
Transcript: ENSMUST00000034896
SMART Domains Protein: ENSMUSP00000034896
Gene: ENSMUSG00000032342

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
Pfam:FAD_binding_2 37 84 1.3e-6 PFAM
Pfam:FAD_oxidored 37 194 2.3e-9 PFAM
Pfam:GIDA 37 435 3.5e-153 PFAM
low complexity region 518 529 N/A INTRINSIC
GIDA_assoc_3 585 658 8.31e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000042235
AA Change: V402I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000042457
Gene: ENSMUSG00000037742
AA Change: V402I

DomainStartEndE-ValueType
Pfam:GTP_EFTU 5 238 3.4e-55 PFAM
Pfam:GTP_EFTU_D2 260 327 6.3e-16 PFAM
Pfam:GTP_EFTU_D3 333 442 5e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126614
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129380
Predicted Effect probably benign
Transcript: ENSMUST00000133002
SMART Domains Protein: ENSMUSP00000123414
Gene: ENSMUSG00000032342

DomainStartEndE-ValueType
GIDA_assoc_3 5 78 8.31e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143570
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144523
Predicted Effect probably benign
Transcript: ENSMUST00000148238
SMART Domains Protein: ENSMUSP00000121424
Gene: ENSMUSG00000032342

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
Pfam:FAD_binding_2 37 84 7.1e-7 PFAM
Pfam:Pyr_redox_2 37 156 2.1e-7 PFAM
Pfam:FAD_oxidored 37 178 1.1e-9 PFAM
Pfam:GIDA 37 184 8.5e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150960
Predicted Effect probably benign
Transcript: ENSMUST00000154207
SMART Domains Protein: ENSMUSP00000120438
Gene: ENSMUSG00000037742

DomainStartEndE-ValueType
Pfam:GTP_EFTU 5 238 1.2e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156988
SMART Domains Protein: ENSMUSP00000116821
Gene: ENSMUSG00000037742

DomainStartEndE-ValueType
Pfam:GTP_EFTU 5 186 1.9e-53 PFAM
Meta Mutation Damage Score 0.076 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an isoform of the alpha subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This isoform (alpha 1) is expressed in brain, placenta, lung, liver, kidney, and pancreas, and the other isoform (alpha 2) is expressed in brain, heart and skeletal muscle. This isoform is identified as an autoantigen in 66% of patients with Felty syndrome. This gene has been found to have multiple copies on many chromosomes, some of which, if not all, represent different pseudogenes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A G 5: 113,101,496 Y122H probably damaging Het
4932431P20Rik T A 7: 29,531,387 noncoding transcript Het
A330070K13Rik A G 5: 130,379,141 probably benign Het
Abcc2 A G 19: 43,833,940 R1406G probably benign Het
Adgrv1 G T 13: 81,386,788 T5786K probably benign Het
Ankrd27 T C 7: 35,615,869 F481S possibly damaging Het
Arhgap11a C T 2: 113,833,122 V939I probably benign Het
Arhgap12 T C 18: 6,037,058 N561S probably benign Het
Arhgef12 T C 9: 43,005,870 H391R probably damaging Het
Asb3 T C 11: 31,101,032 probably benign Het
C2cd5 T C 6: 143,061,738 probably benign Het
Ccdc85a T C 11: 28,583,412 K44R possibly damaging Het
Cep128 C T 12: 91,266,980 R438Q probably benign Het
Cep192 A G 18: 67,858,921 T1957A probably damaging Het
Col20a1 T A 2: 180,998,607 V519E probably damaging Het
Cylc2 A G 4: 51,228,366 K146E possibly damaging Het
Dst T C 1: 34,165,155 probably null Het
Esyt3 T C 9: 99,316,782 probably benign Het
Extl3 A G 14: 65,077,496 V79A possibly damaging Het
Fat3 C T 9: 16,246,916 V1133I probably benign Het
Fcgbp A G 7: 28,093,379 H936R probably damaging Het
Fdxacb1 TAGAC T 9: 50,772,496 probably null Het
Fryl T C 5: 73,072,912 H1634R probably damaging Het
Gm44511 G A 6: 128,820,330 S32L possibly damaging Het
Gm597 T C 1: 28,776,809 E714G possibly damaging Het
Gm8374 G T 14: 7,364,174 N55K probably benign Het
Gria1 T A 11: 57,283,566 I558N probably damaging Het
Gse1 G T 8: 120,574,999 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hectd4 T C 5: 121,328,513 probably null Het
Herc1 T C 9: 66,439,181 I1943T probably benign Het
Ift172 T C 5: 31,285,238 probably benign Het
Ift81 G T 5: 122,568,923 D485E probably benign Het
Lactb T C 9: 66,971,379 probably benign Het
Map1a C T 2: 121,303,925 H1741Y probably benign Het
Map1lc3b T C 8: 121,596,720 Y110H probably benign Het
Mlh1 T C 9: 111,247,377 D304G probably damaging Het
Myo1f A G 17: 33,583,740 D386G probably damaging Het
Ncoa4 T A 14: 32,172,841 probably null Het
Neto1 T C 18: 86,398,019 probably benign Het
Nf1 T C 11: 79,535,983 V1741A possibly damaging Het
Nkain2 C A 10: 32,890,189 probably benign Het
Obsl1 T C 1: 75,492,665 S109G probably damaging Het
Olfr12 T A 1: 92,620,545 I213N probably benign Het
Olfr1347 T A 7: 6,488,362 T171S probably damaging Het
Olfr564 G A 7: 102,804,207 C243Y possibly damaging Het
Olfr615 T C 7: 103,561,119 L214P possibly damaging Het
Phlpp1 T C 1: 106,350,618 V920A possibly damaging Het
Prrxl1 C T 14: 32,608,369 P148S probably benign Het
Psen1 G A 12: 83,724,572 G209R probably damaging Het
Ralgapa2 T G 2: 146,388,500 K963N probably damaging Het
Rdh12 A G 12: 79,209,065 T9A probably benign Het
Rgma G T 7: 73,417,794 A360S probably benign Het
Sag G A 1: 87,828,441 V257I probably benign Het
Scaf1 T C 7: 45,008,297 E386G probably damaging Het
Slc4a10 A G 2: 62,313,286 E1055G probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Spata46 A G 1: 170,312,004 T191A probably benign Het
Tgm2 T A 2: 158,124,252 H494L probably benign Het
Tub C T 7: 109,020,954 R102* probably null Het
Ugt3a1 T G 15: 9,306,292 L176V possibly damaging Het
Vmn2r15 T A 5: 109,294,148 I140L probably benign Het
Wdr44 T G X: 23,796,059 C645G probably damaging Het
Zfp322a C T 13: 23,356,775 V266I probably benign Het
Zfp663 T C 2: 165,352,572 R576G probably damaging Het
Other mutations in Eef1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02105:Eef1a1 APN 9 78480551 missense probably benign 0.03
R5802:Eef1a1 UTSW 9 78479036 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTTCTGGGCAGACTTGGTGAC -3'
(R):5'- TGAACCATCCAGGCCAAATCAGTG -3'

Sequencing Primer
(F):5'- GTCCACAGCTTTGATGACAC -3'
(R):5'- TGCTGGCTACGCTCCTG -3'
Posted On2014-03-17