Incidental Mutation 'R1395:Adgrv1'
ID162827
Institutional Source Beutler Lab
Gene Symbol Adgrv1
Ensembl Gene ENSMUSG00000069170
Gene Nameadhesion G protein-coupled receptor V1
SynonymsMass1, Mgr1, VLGR1, Gpr98
MMRRC Submission 039457-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1395 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location81095068-81633154 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 81386788 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 5786 (T5786K)
Ref Sequence ENSEMBL: ENSMUSP00000093245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095585]
Predicted Effect probably benign
Transcript: ENSMUST00000095585
AA Change: T5786K

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000093245
Gene: ENSMUSG00000069170
AA Change: T5786K

DomainStartEndE-ValueType
Calx_beta 20 116 1.53e-1 SMART
Calx_beta 132 236 1.58e-2 SMART
Calx_beta 251 362 2.33e-2 SMART
Pfam:Calx-beta 380 489 1.1e-3 PFAM
Pfam:Calx-beta 507 616 2.5e-2 PFAM
Pfam:Calx-beta 667 747 9.1e-4 PFAM
Calx_beta 764 862 1.55e-1 SMART
Calx_beta 877 980 1.07e-1 SMART
Calx_beta 994 1094 6.45e-5 SMART
Pfam:Calx-beta 1108 1208 7.4e-4 PFAM
Pfam:Laminin_G_3 1331 1492 4.4e-24 PFAM
Pfam:Calx-beta 1498 1542 6.5e-3 PFAM
Pfam:Calx-beta 1557 1662 1e-6 PFAM
Calx_beta 1706 1805 1.34e-11 SMART
Calx_beta 1846 1948 1.04e-2 SMART
Calx_beta 1962 2075 1.59e-3 SMART
Calx_beta 2103 2202 1.59e-4 SMART
Calx_beta 2218 2320 1.74e-3 SMART
Pfam:Calx-beta 2467 2539 2.1e-4 PFAM
Calx_beta 2576 2672 1.24e-6 SMART
Calx_beta 2687 2786 1.12e-1 SMART
Calx_beta 2810 2921 2.21e-2 SMART
Calx_beta 2945 3044 6.69e-12 SMART
Pfam:Calx-beta 3063 3168 1.2e-5 PFAM
Pfam:Calx-beta 3198 3252 1.2e-1 PFAM
Pfam:EPTP 3391 3434 2.8e-10 PFAM
Pfam:Calx-beta 3577 3623 6.5e-8 PFAM
Pfam:Calx-beta 3637 3737 6e-4 PFAM
Pfam:Calx-beta 3781 3872 6.9e-3 PFAM
Calx_beta 3919 4003 1.18e-2 SMART
Calx_beta 4017 4120 5.44e-2 SMART
Pfam:Calx-beta 4193 4236 2.3e-2 PFAM
Calx_beta 4251 4351 1.43e-20 SMART
Calx_beta 4384 4484 9.46e-3 SMART
Pfam:Calx-beta 4498 4608 2e-2 PFAM
Pfam:Calx-beta 4659 4729 5.1e-2 PFAM
Calx_beta 4989 5089 5.7e-6 SMART
Pfam:Calx-beta 5229 5326 1.9e-6 PFAM
Pfam:Calx-beta 5489 5592 7.2e-5 PFAM
low complexity region 5637 5648 N/A INTRINSIC
GPS 5845 5895 9.48e-3 SMART
Pfam:7tm_2 5902 6141 2.3e-16 PFAM
low complexity region 6227 6240 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125698
SMART Domains Protein: ENSMUSP00000120136
Gene: ENSMUSG00000069170

DomainStartEndE-ValueType
Pfam:Calx-beta 1 47 2e-9 PFAM
Pfam:Calx-beta 79 180 4e-11 PFAM
Pfam:Calx-beta 194 304 9.2e-4 PFAM
Pfam:Calx-beta 354 425 2.9e-3 PFAM
Meta Mutation Damage Score 0.1228 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G-protein coupled receptor superfamily. The encoded protein contains a 7-transmembrane receptor domain, binds calcium and is expressed in the central nervous system. Mutations in this gene are associated with Usher syndrome 2 and familial febrile seizures. Several alternatively spliced transcripts have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a spontaneous and a targeted mutation exhibit high sensitivity to audiogenic seizures. Targeted mutant mice lack the ankle links that connect growing stereocilia in the developing cochlear hair cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A G 5: 113,101,496 Y122H probably damaging Het
4932431P20Rik T A 7: 29,531,387 noncoding transcript Het
A330070K13Rik A G 5: 130,379,141 probably benign Het
Abcc2 A G 19: 43,833,940 R1406G probably benign Het
Ankrd27 T C 7: 35,615,869 F481S possibly damaging Het
Arhgap11a C T 2: 113,833,122 V939I probably benign Het
Arhgap12 T C 18: 6,037,058 N561S probably benign Het
Arhgef12 T C 9: 43,005,870 H391R probably damaging Het
Asb3 T C 11: 31,101,032 probably benign Het
C2cd5 T C 6: 143,061,738 probably benign Het
Ccdc85a T C 11: 28,583,412 K44R possibly damaging Het
Cep128 C T 12: 91,266,980 R438Q probably benign Het
Cep192 A G 18: 67,858,921 T1957A probably damaging Het
Col20a1 T A 2: 180,998,607 V519E probably damaging Het
Cylc2 A G 4: 51,228,366 K146E possibly damaging Het
Dst T C 1: 34,165,155 probably null Het
Eef1a1 C T 9: 78,479,018 V402I probably benign Het
Esyt3 T C 9: 99,316,782 probably benign Het
Extl3 A G 14: 65,077,496 V79A possibly damaging Het
Fat3 C T 9: 16,246,916 V1133I probably benign Het
Fcgbp A G 7: 28,093,379 H936R probably damaging Het
Fdxacb1 TAGAC T 9: 50,772,496 probably null Het
Fryl T C 5: 73,072,912 H1634R probably damaging Het
Gm44511 G A 6: 128,820,330 S32L possibly damaging Het
Gm597 T C 1: 28,776,809 E714G possibly damaging Het
Gm8374 G T 14: 7,364,174 N55K probably benign Het
Gria1 T A 11: 57,283,566 I558N probably damaging Het
Gse1 G T 8: 120,574,999 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hectd4 T C 5: 121,328,513 probably null Het
Herc1 T C 9: 66,439,181 I1943T probably benign Het
Ift172 T C 5: 31,285,238 probably benign Het
Ift81 G T 5: 122,568,923 D485E probably benign Het
Lactb T C 9: 66,971,379 probably benign Het
Map1a C T 2: 121,303,925 H1741Y probably benign Het
Map1lc3b T C 8: 121,596,720 Y110H probably benign Het
Mlh1 T C 9: 111,247,377 D304G probably damaging Het
Myo1f A G 17: 33,583,740 D386G probably damaging Het
Ncoa4 T A 14: 32,172,841 probably null Het
Neto1 T C 18: 86,398,019 probably benign Het
Nf1 T C 11: 79,535,983 V1741A possibly damaging Het
Nkain2 C A 10: 32,890,189 probably benign Het
Obsl1 T C 1: 75,492,665 S109G probably damaging Het
Olfr12 T A 1: 92,620,545 I213N probably benign Het
Olfr1347 T A 7: 6,488,362 T171S probably damaging Het
Olfr564 G A 7: 102,804,207 C243Y possibly damaging Het
Olfr615 T C 7: 103,561,119 L214P possibly damaging Het
Phlpp1 T C 1: 106,350,618 V920A possibly damaging Het
Prrxl1 C T 14: 32,608,369 P148S probably benign Het
Psen1 G A 12: 83,724,572 G209R probably damaging Het
Ralgapa2 T G 2: 146,388,500 K963N probably damaging Het
Rdh12 A G 12: 79,209,065 T9A probably benign Het
Rgma G T 7: 73,417,794 A360S probably benign Het
Sag G A 1: 87,828,441 V257I probably benign Het
Scaf1 T C 7: 45,008,297 E386G probably damaging Het
Slc4a10 A G 2: 62,313,286 E1055G probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Spata46 A G 1: 170,312,004 T191A probably benign Het
Tgm2 T A 2: 158,124,252 H494L probably benign Het
Tub C T 7: 109,020,954 R102* probably null Het
Ugt3a1 T G 15: 9,306,292 L176V possibly damaging Het
Vmn2r15 T A 5: 109,294,148 I140L probably benign Het
Wdr44 T G X: 23,796,059 C645G probably damaging Het
Zfp322a C T 13: 23,356,775 V266I probably benign Het
Zfp663 T C 2: 165,352,572 R576G probably damaging Het
Other mutations in Adgrv1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Adgrv1 APN 13 81405408 critical splice acceptor site probably null
IGL00090:Adgrv1 APN 13 81578101 missense probably damaging 1.00
IGL00091:Adgrv1 APN 13 81578101 missense probably damaging 1.00
IGL00332:Adgrv1 APN 13 81472877 splice site probably benign
IGL00471:Adgrv1 APN 13 81509542 missense probably damaging 0.99
IGL00476:Adgrv1 APN 13 81489074 missense probably damaging 0.98
IGL00508:Adgrv1 APN 13 81506187 missense probably damaging 1.00
IGL00727:Adgrv1 APN 13 81524684 missense probably damaging 0.98
IGL00781:Adgrv1 APN 13 81578230 missense probably benign 0.19
IGL00816:Adgrv1 APN 13 81397203 missense probably benign 0.01
IGL00844:Adgrv1 APN 13 81540119 missense probably damaging 1.00
IGL00923:Adgrv1 APN 13 81382291 missense probably damaging 0.99
IGL01113:Adgrv1 APN 13 81489028 missense probably benign 0.00
IGL01143:Adgrv1 APN 13 81419351 missense probably benign 0.00
IGL01151:Adgrv1 APN 13 81405399 missense probably benign 0.00
IGL01153:Adgrv1 APN 13 81419128 missense probably benign 0.01
IGL01363:Adgrv1 APN 13 81557065 missense probably damaging 1.00
IGL01419:Adgrv1 APN 13 81557158 missense probably damaging 0.99
IGL01545:Adgrv1 APN 13 81466184 missense possibly damaging 0.46
IGL01701:Adgrv1 APN 13 81419631 missense possibly damaging 0.55
IGL01796:Adgrv1 APN 13 81567342 missense probably benign 0.01
IGL01816:Adgrv1 APN 13 81529049 missense probably benign 0.00
IGL01871:Adgrv1 APN 13 81472394 critical splice donor site probably null
IGL01955:Adgrv1 APN 13 81182783 missense probably damaging 1.00
IGL01956:Adgrv1 APN 13 81446430 missense possibly damaging 0.63
IGL01988:Adgrv1 APN 13 81557309 missense probably damaging 0.99
IGL01990:Adgrv1 APN 13 81556996 missense probably damaging 1.00
IGL02007:Adgrv1 APN 13 81568743 splice site probably benign
IGL02016:Adgrv1 APN 13 81397453 missense probably damaging 1.00
IGL02095:Adgrv1 APN 13 81579790 missense possibly damaging 0.63
IGL02174:Adgrv1 APN 13 81427664 missense probably benign 0.34
IGL02270:Adgrv1 APN 13 81559195 unclassified probably null
IGL02328:Adgrv1 APN 13 81578175 missense probably damaging 1.00
IGL02350:Adgrv1 APN 13 81270855 missense probably benign 0.00
IGL02357:Adgrv1 APN 13 81270855 missense probably benign 0.00
IGL02373:Adgrv1 APN 13 81459713 missense possibly damaging 0.90
IGL02402:Adgrv1 APN 13 81559424 missense probably benign 0.18
IGL02407:Adgrv1 APN 13 81479670 missense probably damaging 1.00
IGL02508:Adgrv1 APN 13 81435556 splice site probably benign
IGL02603:Adgrv1 APN 13 81488952 missense possibly damaging 0.93
IGL02648:Adgrv1 APN 13 81511619 missense probably benign 0.35
IGL02720:Adgrv1 APN 13 81578872 missense probably damaging 0.99
IGL02870:Adgrv1 APN 13 81563732 missense probably benign 0.13
IGL02896:Adgrv1 APN 13 81520739 missense probably damaging 1.00
IGL02931:Adgrv1 APN 13 81579714 missense probably damaging 1.00
IGL02952:Adgrv1 APN 13 81433636 missense probably benign 0.00
IGL02961:Adgrv1 APN 13 81523612 missense probably damaging 1.00
IGL02999:Adgrv1 APN 13 81578854 missense probably benign 0.12
IGL03067:Adgrv1 APN 13 81442480 missense probably damaging 1.00
IGL03106:Adgrv1 APN 13 81472899 missense probably benign 0.00
IGL03108:Adgrv1 APN 13 81559529 missense probably damaging 1.00
IGL03119:Adgrv1 APN 13 81382373 missense probably damaging 1.00
IGL03119:Adgrv1 APN 13 81433700 missense probably benign 0.02
IGL03169:Adgrv1 APN 13 81503900 missense probably damaging 1.00
IGL03186:Adgrv1 APN 13 81433618 missense possibly damaging 0.80
IGL03196:Adgrv1 APN 13 81446478 missense probably benign 0.02
IGL03207:Adgrv1 APN 13 81106898 splice site probably null
IGL03343:Adgrv1 APN 13 81283388 missense probably damaging 1.00
IGL03348:Adgrv1 APN 13 81499058 missense possibly damaging 0.54
IGL03349:Adgrv1 APN 13 81481336 missense probably benign 0.09
IGL03373:Adgrv1 APN 13 81563632 missense probably damaging 0.99
IGL03381:Adgrv1 APN 13 81517967 missense probably damaging 0.99
beatle UTSW 13 81579594 nonsense probably null
Metronome UTSW 13 81435559 critical splice donor site probably null
nome UTSW 13 81391767 missense probably benign 0.00
F2404:Adgrv1 UTSW 13 81420006 missense probably benign 0.13
I2288:Adgrv1 UTSW 13 81437524 missense probably damaging 1.00
I2289:Adgrv1 UTSW 13 81437524 missense probably damaging 1.00
R0017:Adgrv1 UTSW 13 81578946 missense probably benign 0.13
R0017:Adgrv1 UTSW 13 81578946 missense probably benign 0.13
R0058:Adgrv1 UTSW 13 81182672 missense possibly damaging 0.65
R0058:Adgrv1 UTSW 13 81182672 missense possibly damaging 0.65
R0083:Adgrv1 UTSW 13 81578404 unclassified probably benign
R0087:Adgrv1 UTSW 13 81386951 missense probably damaging 1.00
R0108:Adgrv1 UTSW 13 81578404 unclassified probably benign
R0131:Adgrv1 UTSW 13 81502995 unclassified probably benign
R0218:Adgrv1 UTSW 13 81106898 splice site probably null
R0325:Adgrv1 UTSW 13 81540015 missense probably damaging 1.00
R0326:Adgrv1 UTSW 13 81474993 missense possibly damaging 0.46
R0395:Adgrv1 UTSW 13 81385953 missense probably benign 0.00
R0441:Adgrv1 UTSW 13 81397226 nonsense probably null
R0466:Adgrv1 UTSW 13 81566296 missense probably benign 0.00
R0487:Adgrv1 UTSW 13 81489035 missense probably damaging 1.00
R0501:Adgrv1 UTSW 13 81559150 missense probably damaging 1.00
R0522:Adgrv1 UTSW 13 81528442 splice site probably benign
R0532:Adgrv1 UTSW 13 81578896 missense probably damaging 1.00
R0542:Adgrv1 UTSW 13 81573318 missense probably damaging 1.00
R0681:Adgrv1 UTSW 13 81528530 missense probably damaging 1.00
R0689:Adgrv1 UTSW 13 81475105 missense possibly damaging 0.47
R0732:Adgrv1 UTSW 13 81503004 missense possibly damaging 0.86
R0746:Adgrv1 UTSW 13 81570556 missense probably benign 0.10
R0763:Adgrv1 UTSW 13 81499125 missense probably damaging 0.98
R0846:Adgrv1 UTSW 13 81479742 nonsense probably null
R0962:Adgrv1 UTSW 13 81405346 missense probably benign 0.01
R1146:Adgrv1 UTSW 13 81531676 missense probably damaging 1.00
R1146:Adgrv1 UTSW 13 81531676 missense probably damaging 1.00
R1172:Adgrv1 UTSW 13 81557063 missense probably damaging 0.98
R1178:Adgrv1 UTSW 13 81440037 splice site probably benign
R1310:Adgrv1 UTSW 13 81566377 missense probably benign 0.09
R1386:Adgrv1 UTSW 13 81528865 missense probably benign 0.17
R1387:Adgrv1 UTSW 13 81493176 missense possibly damaging 0.62
R1412:Adgrv1 UTSW 13 81095450 missense probably damaging 1.00
R1448:Adgrv1 UTSW 13 81433513 missense probably benign 0.08
R1470:Adgrv1 UTSW 13 81382298 missense probably benign 0.03
R1470:Adgrv1 UTSW 13 81382298 missense probably benign 0.03
R1485:Adgrv1 UTSW 13 81579619 missense probably damaging 1.00
R1507:Adgrv1 UTSW 13 81472580 critical splice acceptor site probably null
R1513:Adgrv1 UTSW 13 81556957 missense probably damaging 1.00
R1513:Adgrv1 UTSW 13 81593048 missense probably damaging 1.00
R1539:Adgrv1 UTSW 13 81503978 unclassified probably null
R1579:Adgrv1 UTSW 13 81563779 missense probably damaging 1.00
R1580:Adgrv1 UTSW 13 81466160 critical splice donor site probably null
R1611:Adgrv1 UTSW 13 81559117 missense probably damaging 1.00
R1615:Adgrv1 UTSW 13 81424288 missense probably benign 0.41
R1651:Adgrv1 UTSW 13 81487853 missense probably benign 0.19
R1660:Adgrv1 UTSW 13 81476631 missense probably benign 0.00
R1679:Adgrv1 UTSW 13 81559552 missense probably damaging 1.00
R1709:Adgrv1 UTSW 13 81593060 missense probably damaging 1.00
R1735:Adgrv1 UTSW 13 81487947 missense possibly damaging 0.62
R1762:Adgrv1 UTSW 13 81506146 missense probably benign 0.08
R1830:Adgrv1 UTSW 13 81489077 missense possibly damaging 0.65
R1836:Adgrv1 UTSW 13 81504113 missense probably benign 0.01
R1843:Adgrv1 UTSW 13 81544533 missense probably damaging 1.00
R1863:Adgrv1 UTSW 13 81563566 missense probably damaging 1.00
R1895:Adgrv1 UTSW 13 81374249 missense probably damaging 1.00
R1907:Adgrv1 UTSW 13 81592551 splice site probably benign
R1928:Adgrv1 UTSW 13 81520786 missense probably benign 0.00
R1938:Adgrv1 UTSW 13 81391757 missense probably damaging 0.99
R1944:Adgrv1 UTSW 13 81510911 missense probably damaging 1.00
R1946:Adgrv1 UTSW 13 81374249 missense probably damaging 1.00
R1984:Adgrv1 UTSW 13 81523749 missense probably damaging 1.00
R2027:Adgrv1 UTSW 13 81595182 missense probably damaging 1.00
R2063:Adgrv1 UTSW 13 81561469 missense possibly damaging 0.81
R2116:Adgrv1 UTSW 13 81529013 missense probably benign 0.11
R2117:Adgrv1 UTSW 13 81492537 missense probably benign 0.00
R2125:Adgrv1 UTSW 13 81419535 missense probably benign 0.00
R2125:Adgrv1 UTSW 13 81419950 missense probably benign 0.02
R2127:Adgrv1 UTSW 13 81557080 missense probably damaging 1.00
R2128:Adgrv1 UTSW 13 81557080 missense probably damaging 1.00
R2129:Adgrv1 UTSW 13 81557080 missense probably damaging 1.00
R2130:Adgrv1 UTSW 13 81581727 missense possibly damaging 0.61
R2135:Adgrv1 UTSW 13 81524557 critical splice donor site probably null
R2138:Adgrv1 UTSW 13 81445320 missense probably benign 0.00
R2166:Adgrv1 UTSW 13 81568643 missense probably damaging 1.00
R2171:Adgrv1 UTSW 13 81270918 missense probably damaging 1.00
R2191:Adgrv1 UTSW 13 81566290 missense possibly damaging 0.90
R2256:Adgrv1 UTSW 13 81506140 missense probably benign
R2260:Adgrv1 UTSW 13 81568374 missense probably damaging 0.97
R2323:Adgrv1 UTSW 13 81595179 missense probably damaging 1.00
R2432:Adgrv1 UTSW 13 81540132 frame shift probably null
R2910:Adgrv1 UTSW 13 81557119 missense possibly damaging 0.61
R2920:Adgrv1 UTSW 13 81448865 missense probably benign 0.01
R2989:Adgrv1 UTSW 13 81581747 missense probably damaging 1.00
R3402:Adgrv1 UTSW 13 81543542 missense probably damaging 1.00
R3692:Adgrv1 UTSW 13 81524600 missense possibly damaging 0.91
R3711:Adgrv1 UTSW 13 81419475 missense probably benign 0.02
R3732:Adgrv1 UTSW 13 81556956 missense probably damaging 1.00
R3732:Adgrv1 UTSW 13 81556956 missense probably damaging 1.00
R3733:Adgrv1 UTSW 13 81556956 missense probably damaging 1.00
R3773:Adgrv1 UTSW 13 81499043 missense probably damaging 0.98
R3791:Adgrv1 UTSW 13 81593102 missense probably damaging 1.00
R3794:Adgrv1 UTSW 13 81283367 start codon destroyed probably damaging 1.00
R3848:Adgrv1 UTSW 13 81440072 missense probably damaging 0.97
R3880:Adgrv1 UTSW 13 81435705 missense probably benign 0.02
R3925:Adgrv1 UTSW 13 81578772 missense possibly damaging 0.89
R3934:Adgrv1 UTSW 13 81475047 missense probably benign 0.06
R3942:Adgrv1 UTSW 13 81182789 missense probably damaging 1.00
R4002:Adgrv1 UTSW 13 81540132 frame shift probably null
R4003:Adgrv1 UTSW 13 81540132 frame shift probably null
R4194:Adgrv1 UTSW 13 81498996 missense probably damaging 0.98
R4308:Adgrv1 UTSW 13 81440192 missense probably damaging 0.96
R4368:Adgrv1 UTSW 13 81492910 missense unknown
R4388:Adgrv1 UTSW 13 81581709 missense probably damaging 0.98
R4421:Adgrv1 UTSW 13 81566302 missense probably damaging 1.00
R4468:Adgrv1 UTSW 13 81374256 missense probably benign 0.01
R4483:Adgrv1 UTSW 13 81419230 missense probably benign 0.01
R4487:Adgrv1 UTSW 13 81440066 missense probably damaging 0.99
R4566:Adgrv1 UTSW 13 81419808 missense probably damaging 1.00
R4615:Adgrv1 UTSW 13 81494569 splice site probably null
R4647:Adgrv1 UTSW 13 81528795 nonsense probably null
R4657:Adgrv1 UTSW 13 81405364 missense probably benign 0.01
R4723:Adgrv1 UTSW 13 81433525 missense probably benign 0.02
R4765:Adgrv1 UTSW 13 81106919 missense probably damaging 0.99
R4783:Adgrv1 UTSW 13 81095445 missense probably damaging 0.99
R4796:Adgrv1 UTSW 13 81155231 nonsense probably null
R4816:Adgrv1 UTSW 13 81528674 missense probably damaging 1.00
R4833:Adgrv1 UTSW 13 81560844 missense possibly damaging 0.81
R4841:Adgrv1 UTSW 13 81503001 critical splice donor site probably null
R4871:Adgrv1 UTSW 13 81533122 intron probably benign
R4897:Adgrv1 UTSW 13 81561585 splice site probably null
R4906:Adgrv1 UTSW 13 81270738 splice site probably null
R4917:Adgrv1 UTSW 13 81510877 missense probably benign 0.30
R4996:Adgrv1 UTSW 13 81578734 missense probably benign 0.01
R5030:Adgrv1 UTSW 13 81459829 missense probably benign 0.43
R5044:Adgrv1 UTSW 13 81488931 missense probably benign 0.01
R5052:Adgrv1 UTSW 13 81528821 missense probably damaging 0.97
R5093:Adgrv1 UTSW 13 81592585 missense probably damaging 1.00
R5095:Adgrv1 UTSW 13 81095487 missense probably benign 0.00
R5119:Adgrv1 UTSW 13 81419427 missense possibly damaging 0.93
R5133:Adgrv1 UTSW 13 81439441 missense probably damaging 1.00
R5141:Adgrv1 UTSW 13 81270918 missense probably damaging 1.00
R5164:Adgrv1 UTSW 13 81435674 missense probably benign 0.00
R5180:Adgrv1 UTSW 13 81283416 start gained probably benign
R5203:Adgrv1 UTSW 13 81510905 missense possibly damaging 0.91
R5241:Adgrv1 UTSW 13 81488929 nonsense probably null
R5280:Adgrv1 UTSW 13 81397465 missense possibly damaging 0.95
R5289:Adgrv1 UTSW 13 81521084 missense probably benign 0.04
R5304:Adgrv1 UTSW 13 81578253 missense possibly damaging 0.93
R5310:Adgrv1 UTSW 13 81476690 missense possibly damaging 0.95
R5338:Adgrv1 UTSW 13 81529046 missense possibly damaging 0.80
R5352:Adgrv1 UTSW 13 81494657 missense probably damaging 1.00
R5402:Adgrv1 UTSW 13 81459715 missense probably benign 0.25
R5418:Adgrv1 UTSW 13 81419308 missense probably benign 0.01
R5460:Adgrv1 UTSW 13 81424258 missense possibly damaging 0.95
R5510:Adgrv1 UTSW 13 81445244 missense probably damaging 1.00
R5521:Adgrv1 UTSW 13 81419389 missense probably benign 0.01
R5538:Adgrv1 UTSW 13 81433689 missense probably benign 0.02
R5561:Adgrv1 UTSW 13 81476564 missense probably damaging 0.99
R5584:Adgrv1 UTSW 13 81405267 missense probably damaging 1.00
R5608:Adgrv1 UTSW 13 81155276 missense probably damaging 1.00
R5610:Adgrv1 UTSW 13 81521117 missense probably damaging 1.00
R5619:Adgrv1 UTSW 13 81472500 missense probably damaging 1.00
R5751:Adgrv1 UTSW 13 81522236 missense probably damaging 1.00
R5832:Adgrv1 UTSW 13 81103302 missense possibly damaging 0.95
R5885:Adgrv1 UTSW 13 81424271 missense probably benign 0.15
R5930:Adgrv1 UTSW 13 81397451 missense probably benign 0.06
R5937:Adgrv1 UTSW 13 81107075 missense probably damaging 0.96
R5943:Adgrv1 UTSW 13 81386866 missense probably damaging 0.98
R5951:Adgrv1 UTSW 13 81442501 missense probably damaging 1.00
R5977:Adgrv1 UTSW 13 81435559 critical splice donor site probably null
R5995:Adgrv1 UTSW 13 81466259 missense probably benign 0.03
R6017:Adgrv1 UTSW 13 81397423 nonsense probably null
R6024:Adgrv1 UTSW 13 81476505 missense probably benign 0.26
R6049:Adgrv1 UTSW 13 81397354 missense probably benign 0.00
R6108:Adgrv1 UTSW 13 81391695 missense probably damaging 0.99
R6130:Adgrv1 UTSW 13 81427745 missense probably damaging 0.99
R6132:Adgrv1 UTSW 13 81506076 missense probably benign 0.04
R6149:Adgrv1 UTSW 13 81182774 missense probably damaging 1.00
R6169:Adgrv1 UTSW 13 81419259 missense probably benign 0.00
R6175:Adgrv1 UTSW 13 81386005 missense probably damaging 1.00
R6184:Adgrv1 UTSW 13 81433838 missense probably benign 0.01
R6190:Adgrv1 UTSW 13 81459763 synonymous probably null
R6190:Adgrv1 UTSW 13 81524779 splice site probably null
R6215:Adgrv1 UTSW 13 81579594 nonsense probably null
R6216:Adgrv1 UTSW 13 81524471 intron probably null
R6238:Adgrv1 UTSW 13 81466283 missense probably benign 0.07
R6244:Adgrv1 UTSW 13 81106931 missense probably damaging 1.00
R6298:Adgrv1 UTSW 13 81391767 missense probably benign 0.00
R6316:Adgrv1 UTSW 13 81499068 missense possibly damaging 0.63
R6336:Adgrv1 UTSW 13 81385981 missense probably benign 0.09
R6358:Adgrv1 UTSW 13 81414583 missense probably damaging 0.99
R6421:Adgrv1 UTSW 13 81508736 missense possibly damaging 0.69
R6466:Adgrv1 UTSW 13 81575101 unclassified probably null
R6467:Adgrv1 UTSW 13 81444538 missense probably benign 0.01
R6510:Adgrv1 UTSW 13 81559490 missense possibly damaging 0.88
R6519:Adgrv1 UTSW 13 81567343 missense probably benign 0.01
R6521:Adgrv1 UTSW 13 81433652 missense probably damaging 1.00
R6598:Adgrv1 UTSW 13 81506179 missense probably damaging 1.00
R6605:Adgrv1 UTSW 13 81487962 missense possibly damaging 0.80
R6626:Adgrv1 UTSW 13 81518126 missense probably damaging 1.00
R6633:Adgrv1 UTSW 13 81568643 missense probably damaging 1.00
R6721:Adgrv1 UTSW 13 81481515 missense probably benign 0.00
R6725:Adgrv1 UTSW 13 81437557 missense probably damaging 0.99
R6725:Adgrv1 UTSW 13 81493210 missense probably damaging 1.00
R6796:Adgrv1 UTSW 13 81472478 missense probably damaging 1.00
R6809:Adgrv1 UTSW 13 81472953 missense probably benign 0.01
R6823:Adgrv1 UTSW 13 81557081 missense probably damaging 1.00
R6876:Adgrv1 UTSW 13 81155154 critical splice donor site probably null
R6878:Adgrv1 UTSW 13 81433494 missense probably benign 0.06
R6887:Adgrv1 UTSW 13 81528701 missense probably benign 0.01
R6888:Adgrv1 UTSW 13 81508669 missense probably damaging 1.00
R6957:Adgrv1 UTSW 13 81567490 missense probably benign 0.00
R6976:Adgrv1 UTSW 13 81520997 missense probably damaging 1.00
X0054:Adgrv1 UTSW 13 81559270 missense probably damaging 1.00
X0062:Adgrv1 UTSW 13 81386926 missense probably damaging 0.99
X0067:Adgrv1 UTSW 13 81543392 missense possibly damaging 0.51
Z1088:Adgrv1 UTSW 13 81476672 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTAGCTTCGCCAACTCCAC -3'
(R):5'- GCAAAACCATCCTTGACAGTTGCCC -3'

Sequencing Primer
(F):5'- cacacacacacacacacac -3'
(R):5'- GACAGTTGCCCATATCTGTCAATTC -3'
Posted On2014-03-17