Incidental Mutation 'R1364:Cobll1'
ID162846
Institutional Source Beutler Lab
Gene Symbol Cobll1
Ensembl Gene ENSMUSG00000034903
Gene NameCobl-like 1
SynonymsD430044D16Rik, Coblr1
MMRRC Submission 039429-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #R1364 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location65088339-65239403 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 65126310 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090896] [ENSMUST00000102726] [ENSMUST00000112429] [ENSMUST00000112430] [ENSMUST00000112431] [ENSMUST00000155916]
Predicted Effect probably benign
Transcript: ENSMUST00000090896
SMART Domains Protein: ENSMUSP00000088412
Gene: ENSMUSG00000034903

DomainStartEndE-ValueType
low complexity region 147 158 N/A INTRINSIC
Pfam:Cobl 186 264 1.3e-38 PFAM
low complexity region 332 343 N/A INTRINSIC
low complexity region 426 438 N/A INTRINSIC
low complexity region 1023 1034 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102726
SMART Domains Protein: ENSMUSP00000099787
Gene: ENSMUSG00000034903

DomainStartEndE-ValueType
low complexity region 147 158 N/A INTRINSIC
Pfam:Cobl 186 264 5.6e-39 PFAM
low complexity region 332 343 N/A INTRINSIC
low complexity region 464 476 N/A INTRINSIC
low complexity region 1060 1071 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112429
SMART Domains Protein: ENSMUSP00000108048
Gene: ENSMUSG00000034903

DomainStartEndE-ValueType
Pfam:Cobl 148 239 5.4e-49 PFAM
low complexity region 332 343 N/A INTRINSIC
low complexity region 464 476 N/A INTRINSIC
low complexity region 1061 1072 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112430
SMART Domains Protein: ENSMUSP00000108049
Gene: ENSMUSG00000034903

DomainStartEndE-ValueType
low complexity region 146 157 N/A INTRINSIC
Pfam:Cobl 185 263 1.3e-38 PFAM
low complexity region 331 342 N/A INTRINSIC
low complexity region 425 437 N/A INTRINSIC
low complexity region 1022 1033 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112431
SMART Domains Protein: ENSMUSP00000108050
Gene: ENSMUSG00000034903

DomainStartEndE-ValueType
low complexity region 147 158 N/A INTRINSIC
Pfam:Cobl 186 264 5.6e-39 PFAM
low complexity region 332 343 N/A INTRINSIC
low complexity region 464 476 N/A INTRINSIC
low complexity region 1061 1072 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155916
SMART Domains Protein: ENSMUSP00000115065
Gene: ENSMUSG00000034903

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
low complexity region 167 178 N/A INTRINSIC
Pfam:Cobl 206 297 2.4e-37 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.8%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,987,030 F2519S probably damaging Het
Ahi1 T A 10: 20,972,156 L488I probably damaging Het
Csn1s1 T C 5: 87,677,584 probably benign Het
D430041D05Rik A T 2: 104,155,018 S1920T possibly damaging Het
Dnah17 T A 11: 118,125,606 probably benign Het
Fam126a T C 5: 23,965,353 T333A probably benign Het
Fanca G A 8: 123,304,281 probably benign Het
Fnbp1 T C 2: 31,059,031 probably benign Het
Herc1 T A 9: 66,400,093 L1023Q probably damaging Het
Hjurp T TN 1: 88,266,525 probably null Het
Kcnt1 A G 2: 25,908,094 M906V probably damaging Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mid1 A C X: 169,986,094 N215H probably damaging Het
Mug1 T A 6: 121,881,713 L1130Q probably damaging Het
Nebl A T 2: 17,393,037 probably benign Het
Olfr1491 T C 19: 13,705,445 V206A probably benign Het
Otud7b A G 3: 96,151,451 D320G probably damaging Het
Piezo1 T C 8: 122,498,571 E563G possibly damaging Het
Prkd3 T C 17: 78,957,258 T643A probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Rasl10b G A 11: 83,417,839 probably null Het
Ripk3 A C 14: 55,785,260 probably null Het
Sgsm3 T C 15: 81,007,942 F237S probably damaging Het
Slit3 G A 11: 35,670,107 V960I probably benign Het
Sptbn2 T C 19: 4,732,665 L543P probably damaging Het
Tll2 G A 19: 41,120,228 R328C probably damaging Het
Unkl A G 17: 25,189,623 I54V probably benign Het
Wdr75 A G 1: 45,799,062 T44A probably benign Het
Other mutations in Cobll1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00789:Cobll1 APN 2 65126013 missense probably damaging 1.00
IGL01074:Cobll1 APN 2 65107848 missense probably damaging 1.00
IGL01093:Cobll1 APN 2 65098237 missense probably damaging 1.00
IGL02411:Cobll1 APN 2 65097740 missense probably damaging 1.00
IGL02419:Cobll1 APN 2 65151048 missense probably damaging 1.00
IGL02550:Cobll1 APN 2 65107863 missense probably damaging 1.00
IGL02607:Cobll1 APN 2 65151085 missense probably damaging 0.98
IGL02829:Cobll1 APN 2 65126045 missense probably damaging 1.00
IGL02802:Cobll1 UTSW 2 65098319 missense probably damaging 0.99
R0313:Cobll1 UTSW 2 65095744 nonsense probably null
R0314:Cobll1 UTSW 2 65089521 missense possibly damaging 0.81
R0322:Cobll1 UTSW 2 65102098 missense possibly damaging 0.84
R0846:Cobll1 UTSW 2 65102065 splice site probably null
R1163:Cobll1 UTSW 2 65098279 missense probably damaging 0.96
R1242:Cobll1 UTSW 2 65151169 critical splice acceptor site probably null
R1445:Cobll1 UTSW 2 65099136 missense probably damaging 1.00
R1610:Cobll1 UTSW 2 65133642 missense probably damaging 1.00
R1836:Cobll1 UTSW 2 65126236 missense probably damaging 1.00
R2102:Cobll1 UTSW 2 65098210 missense probably damaging 1.00
R3154:Cobll1 UTSW 2 65107050 missense probably benign 0.00
R4580:Cobll1 UTSW 2 65151073 missense probably benign 0.00
R4638:Cobll1 UTSW 2 65099237 missense probably benign 0.03
R4684:Cobll1 UTSW 2 65099028 missense possibly damaging 0.90
R4906:Cobll1 UTSW 2 65097693 missense probably benign 0.01
R4923:Cobll1 UTSW 2 65099258 missense possibly damaging 0.87
R5100:Cobll1 UTSW 2 65125901 missense probably benign 0.26
R5269:Cobll1 UTSW 2 65133771 nonsense probably null
R5419:Cobll1 UTSW 2 65103357 missense possibly damaging 0.57
R5637:Cobll1 UTSW 2 65125903 missense possibly damaging 0.90
R5745:Cobll1 UTSW 2 65098457 missense probably damaging 0.99
R5777:Cobll1 UTSW 2 65103268 missense probably benign 0.27
R6303:Cobll1 UTSW 2 65098033 missense possibly damaging 0.68
R6471:Cobll1 UTSW 2 65107884 missense probably damaging 1.00
X0020:Cobll1 UTSW 2 65103322 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAAAGATGGACGATGCTTGCTCAC -3'
(R):5'- GAATTCACTGTCTAGCTGTGCCTCC -3'

Sequencing Primer
(F):5'- CAGGAGCACTGGCAGTCTAAC -3'
(R):5'- CACTTCATTCTCATCTAACGTGG -3'
Posted On2014-03-17